ID: 1133630649

View in Genome Browser
Species Human (GRCh38)
Location 16:7617142-7617164
Sequence ACAGCTTGTTAGCTTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133630647_1133630649 13 Left 1133630647 16:7617106-7617128 CCAAGCCAAATTTAGTTATGAAA 0: 1
1: 1
2: 2
3: 18
4: 371
Right 1133630649 16:7617142-7617164 ACAGCTTGTTAGCTTAAAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 95
1133630648_1133630649 8 Left 1133630648 16:7617111-7617133 CCAAATTTAGTTATGAAAGAGAA 0: 1
1: 0
2: 3
3: 45
4: 404
Right 1133630649 16:7617142-7617164 ACAGCTTGTTAGCTTAAAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133630649 Original CRISPR ACAGCTTGTTAGCTTAAAGC AGG Intronic
904013176 1:27401881-27401903 ACAGCTTCTTAGGTAAAGGCAGG + Intergenic
905175376 1:36131949-36131971 ACAGCTTGTCAGCACAAAGTAGG - Intergenic
907811159 1:57871449-57871471 ACAGCTAGTAAGCTTAGAGCTGG + Intronic
908291123 1:62668411-62668433 ACAGCTGGTTTGCTCAAATCAGG - Intronic
914328899 1:146647988-146648010 ACAACTTCTTAGCATACAGCTGG - Intergenic
917197988 1:172486661-172486683 ACAGCTTAGTGGCTAAAAGCAGG + Intergenic
1065843102 10:29721787-29721809 ACTGCTTATTAGTATAAAGCAGG - Intronic
1068837669 10:61571967-61571989 ACAGCTAGCTAGAATAAAGCAGG + Intergenic
1070410591 10:76136006-76136028 ATAGATTGTTATCTTGAAGCAGG + Intronic
1071928220 10:90436084-90436106 ACTGCCCGTTAGCTTAAAGCAGG - Intergenic
1072829708 10:98644844-98644866 ACAGCTTGTAAGGGTAAAACTGG - Intronic
1078185476 11:9048442-9048464 ACAGTTGGTTTGCATAAAGCTGG + Intronic
1079418889 11:20267559-20267581 ACAGCTTAATTGGTTAAAGCTGG + Intergenic
1088627355 11:111739061-111739083 AAAGCTTGTTTCCTGAAAGCAGG + Intronic
1091317801 11:134627039-134627061 GCAGCTTGTAAATTTAAAGCTGG + Intergenic
1093763304 12:22934894-22934916 ACAGCTTGTGAGGTTAAGTCTGG - Intergenic
1093773499 12:23045329-23045351 ACAATTTGTTAGCATAAAGAAGG - Intergenic
1094019894 12:25902975-25902997 AAAGCTGGTGAACTTAAAGCTGG - Intergenic
1097510986 12:60539831-60539853 ACAGCTTGATTGATTATAGCCGG - Intergenic
1100741375 12:97597094-97597116 ACAGCTTGTTAGAATGATGCAGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1106629252 13:31453113-31453135 AGTGCTTGTTAGCTTAAAGTAGG - Intergenic
1106947379 13:34843728-34843750 AGAGCTTGTTTGCTGAAAGCAGG + Intergenic
1106971573 13:35147231-35147253 ACAGATTGTTAGCATAAGCCTGG + Intronic
1108991664 13:56666265-56666287 ACAGCTTGTTAGCTGAGGGTGGG + Intergenic
1110726854 13:78835895-78835917 ACAGCTTAGTAGCACAAAGCTGG - Intergenic
1111622318 13:90740307-90740329 ACAGCTTGATTGGTTAAACCTGG + Intergenic
1112228853 13:97567996-97568018 ACAGCTTGATGACTCAAAGCAGG + Intergenic
1114250563 14:20956597-20956619 TCAGCTTCTCAGCCTAAAGCAGG - Intergenic
1118379434 14:65205473-65205495 ACAGCTTGTTGGGTTTAAGAAGG - Intergenic
1121517780 14:94564447-94564469 TCAGCTTGTTTGCTCAAAGCAGG + Intronic
1127636343 15:60874066-60874088 ACAGCTGTTTATCTTAAATCTGG + Intronic
1133630649 16:7617142-7617164 ACAGCTTGTTAGCTTAAAGCAGG + Intronic
1134909749 16:18014079-18014101 ATAGCTTGATAGGTTACAGCTGG - Intergenic
1139227481 16:65247142-65247164 ACAGGTTGGTAGCTTGAAGGAGG - Intergenic
1140004669 16:71062955-71062977 ACAACTTCTTAGCTTACAGCTGG + Intronic
1148210538 17:45806006-45806028 ACATCATGTAAGCTTAAAGGGGG + Intronic
1148637694 17:49161296-49161318 ACAGCTTGTCAAATTAAAGGAGG + Intronic
1152973963 18:195361-195383 ACAGCATCTTAGCACAAAGCAGG - Intronic
1153171614 18:2323085-2323107 ACACATTGTTAGCATAAGGCAGG + Intergenic
1156859401 18:41818526-41818548 ACAGCTAGAGAGTTTAAAGCAGG - Intergenic
930820320 2:55639947-55639969 ACAGCTGGTTATCTTAAAACAGG - Intronic
931614207 2:64139152-64139174 ACAGTTAGTTTGCTCAAAGCAGG + Intronic
935439754 2:103078207-103078229 ACAACTTCCTAGCTTAAATCAGG - Intergenic
936533308 2:113291702-113291724 ACTGCTTGTTAGAGAAAAGCGGG + Intergenic
938631913 2:133176951-133176973 ACACATTTTTAGCTTAAAGAGGG - Intronic
939475797 2:142685188-142685210 GCACTTTGGTAGCTTAAAGCAGG - Intergenic
946110528 2:217411296-217411318 ACTGCTTGTCTGCTTAATGCTGG - Intronic
946559670 2:220898332-220898354 ACTTTTTGTTAGCCTAAAGCAGG + Intergenic
947011909 2:225575232-225575254 ACAGCTTTAGAGCTTACAGCTGG + Intronic
1170170119 20:13401287-13401309 ACAGCTTTTGATCTTAAATCTGG + Intronic
1172743341 20:37186687-37186709 ACAGTTAGTTGGCTTAAATCAGG + Intronic
1173942749 20:46925785-46925807 ACAGATTGCTAGATTAAAGGAGG - Intronic
1178668187 21:34567045-34567067 CAAGTTTGTTAGTTTAAAGCTGG - Intronic
1179729494 21:43359859-43359881 ACAGCATGGTATTTTAAAGCAGG + Intergenic
1181885951 22:26022667-26022689 TCAGCTGGTGAGCTTAAAACAGG - Intronic
1183900390 22:41001477-41001499 ATAGCATTTTAGCTCAAAGCAGG - Intergenic
949750123 3:7342617-7342639 ACAGAATGTTAAGTTAAAGCAGG + Intronic
951962420 3:28343314-28343336 ACAGTTTGTTAACTTCCAGCAGG + Intronic
954727765 3:52629604-52629626 ATAACTTGGCAGCTTAAAGCTGG + Intronic
954742360 3:52763776-52763798 ACAACTTGTTATCTTACAACTGG - Intronic
956223610 3:66931405-66931427 ACAGCCTGTCAGATAAAAGCTGG - Intergenic
958639662 3:96789401-96789423 GAAGCTTTTTAGCTTAATGCAGG + Intergenic
962619669 3:137164983-137165005 ACAGATTCTTAGCCTAGAGCAGG - Intergenic
963358722 3:144243146-144243168 TCAGCCTTTTAGCTGAAAGCAGG - Intergenic
965124281 3:164604911-164604933 ACAGCTTGATTGATTACAGCTGG - Intergenic
975106683 4:70575098-70575120 ACAGCTGGCTCACTTAAAGCAGG + Intergenic
976750174 4:88445295-88445317 ACAGCTTGTTTGCTTCACGTTGG - Intergenic
978080851 4:104589686-104589708 ACAGTTTGTTTGGTTAAGGCTGG - Intergenic
989179970 5:38566933-38566955 TCACCTTGGTAGCTTAAAGTTGG - Intronic
991229828 5:64320102-64320124 AGAGCTTGTTAAATTAATGCTGG - Intronic
992793972 5:80239016-80239038 ACAGCTAGTCAGCTCACAGCAGG - Intronic
993117029 5:83731959-83731981 ATATCTTGTAAGTTTAAAGCAGG + Intergenic
996441669 5:123498245-123498267 AAAGCTTGTTATTTTAAAGAAGG - Intergenic
997822140 5:137075804-137075826 GCAGTTTGGGAGCTTAAAGCAGG - Intronic
998663735 5:144271564-144271586 AAAGCTTTTTCTCTTAAAGCAGG + Intronic
1001831724 5:174794675-174794697 ACAACTTGTTATTATAAAGCGGG + Intergenic
1002380759 5:178827724-178827746 TCAGCTTGGTAGCTTGAATCTGG + Intergenic
1004931932 6:20470738-20470760 ACAGTTTGTTAACATACAGCAGG + Intronic
1011232639 6:85179932-85179954 ACAGCTTGATAGTTAAAATCAGG + Intergenic
1013396487 6:109746296-109746318 ACAGGCTGTTAGCTCAAGGCAGG - Intronic
1019648826 7:2145287-2145309 CCTGCTTGTTAGCTTTATGCGGG - Intronic
1020410809 7:7889556-7889578 ACAACTGGTTTGCTTAAAGGGGG - Intronic
1020848992 7:13325232-13325254 ACAGCTTGTCATATTAAAGGGGG + Intergenic
1026937678 7:74268131-74268153 AGAACTTCTTAGCTTAAAGTGGG - Intergenic
1027750018 7:82131374-82131396 ACAGCTTGATTGGTTATAGCTGG - Intronic
1028997387 7:97116500-97116522 ACAGCTTGATTGCTTACAGTTGG + Intergenic
1031427351 7:121621692-121621714 AAAGCTTGTTAGGCTAGAGCAGG + Intergenic
1031696250 7:124858143-124858165 ACAGCTAGTTGGATTGAAGCAGG - Intronic
1033871408 7:145758508-145758530 ACAGATTGTTAGCTTAGGGTGGG - Intergenic
1043763975 8:84105657-84105679 AAAGCTTCTTTACTTAAAGCTGG + Intergenic
1047608415 8:126497140-126497162 AGAGCTTGTTAGATTAAAGATGG + Intergenic
1050944480 9:11500173-11500195 ACAGCTTGAAGGCTAAAAGCAGG - Intergenic
1051596356 9:18827909-18827931 AAAGTTTGTTAGCTTTTAGCAGG + Intronic
1053668538 9:40336389-40336411 ACAGCTTGTGGGCTGAATGCAGG - Intergenic
1053918344 9:42962678-42962700 ACAGCTTGTGGGCTGAATGCAGG - Intergenic
1054379677 9:64476442-64476464 ACAGCTTGTGGGCTGAATGCAGG - Intergenic
1054516073 9:66039905-66039927 ACAGCTTGTGGGCTGAATGCAGG + Intergenic
1060929353 9:127479220-127479242 ACAGCTTGTTTTCTTACAGTTGG + Intronic
1062013723 9:134280780-134280802 CGAGCTTGTTTGCCTAAAGCTGG + Intergenic
1196899134 X:120366089-120366111 ACAGGGTGTTAGGATAAAGCTGG + Intronic
1198119919 X:133582064-133582086 TCACATTGGTAGCTTAAAGCTGG - Intronic
1200377754 X:155802205-155802227 ACAGTTTGTTTGCTTGAATCAGG + Intergenic
1201547973 Y:15187096-15187118 ACAGATTGTTAGATCAAAGATGG + Intergenic