ID: 1133631806

View in Genome Browser
Species Human (GRCh38)
Location 16:7629134-7629156
Sequence CAGGTAGAACCTCTGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133631802_1133631806 -7 Left 1133631802 16:7629118-7629140 CCATGGGACATTCCTTCAGGTAG 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1133631806 16:7629134-7629156 CAGGTAGAACCTCTGGCCCTGGG 0: 1
1: 0
2: 2
3: 14
4: 162
1133631800_1133631806 8 Left 1133631800 16:7629103-7629125 CCAGATCGAAAAAGACCATGGGA 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1133631806 16:7629134-7629156 CAGGTAGAACCTCTGGCCCTGGG 0: 1
1: 0
2: 2
3: 14
4: 162
1133631797_1133631806 28 Left 1133631797 16:7629083-7629105 CCAGCTATAAGCATGGGAAACCA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1133631806 16:7629134-7629156 CAGGTAGAACCTCTGGCCCTGGG 0: 1
1: 0
2: 2
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133631806 Original CRISPR CAGGTAGAACCTCTGGCCCT GGG Intronic
900953613 1:5873564-5873586 CAGGTGGGACCTCAGGCCTTTGG - Intronic
901412613 1:9094973-9094995 TAGGTATAACCTCTGGGACTGGG + Intergenic
901673617 1:10869914-10869936 CAGGTAGCCCCTCAGGTCCTAGG - Intergenic
903649213 1:24912896-24912918 CAGATAGCAGCTCTGGGCCTGGG - Intronic
904046276 1:27610829-27610851 CAGCCAGAAACTGTGGCCCTTGG + Intergenic
904379330 1:30100714-30100736 CAGTCAGAACCTCTGGGCTTAGG + Intergenic
907585175 1:55610700-55610722 CAGGGATAAGATCTGGCCCTAGG + Intergenic
907928790 1:58979686-58979708 CCAGTAGAAACTCAGGCCCTCGG + Intergenic
910154090 1:84193314-84193336 CAGGGAGAATCACTGGCCCTGGG - Intronic
911972364 1:104454220-104454242 CAAGTAGCAGCTCTGGCCCATGG - Intergenic
914405798 1:147371026-147371048 CAGGAAGGACCACTGTCCCTTGG - Intergenic
914827316 1:151145539-151145561 CAGGTCGAGCCCCTGGCCCTAGG - Intronic
915086135 1:153390322-153390344 CAGGGAGGACCGCTGGCCCAGGG + Intronic
915276725 1:154793985-154794007 CAGGCAGAACCTCTAGCCCTGGG - Intronic
916081107 1:161232965-161232987 TAGCTAGAGGCTCTGGCCCTAGG + Intronic
916244375 1:162672333-162672355 CAGGTAGATGCTCTGGCTCCTGG + Intronic
917162199 1:172070291-172070313 TAGGGAGAACCTCTGGCCCTAGG - Intronic
917633668 1:176915245-176915267 CGGGTAGAACACCTGGCCCATGG - Intronic
919001700 1:191840310-191840332 CATCTAGAACTTCTGGCCTTTGG + Intergenic
919947005 1:202326913-202326935 CAGGTAGAGACTGTGGGCCTGGG + Intergenic
922254063 1:223876288-223876310 CAGGTAGAATCTCTGGGTGTAGG + Intergenic
922483581 1:225956354-225956376 CAGGTGGATCCTCGGGCCCCAGG - Intergenic
922789949 1:228305974-228305996 GAGGTGGAACCTATAGCCCTGGG + Intronic
1062897706 10:1116876-1116898 CAGAAAGAACCACTGGGCCTAGG - Intronic
1064246245 10:13669686-13669708 CAGGTATACCCTCAGGCCCAGGG - Intronic
1069602408 10:69716548-69716570 CCGGCAGAGCCTCTGTCCCTTGG + Intergenic
1073481174 10:103787007-103787029 CAGGGAGCTCCTCAGGCCCTAGG + Intronic
1073893555 10:108127218-108127240 TATATAGAAACTCTGGCCCTAGG - Intergenic
1076300228 10:129419956-129419978 CAGGTAGCACAGCTGACCCTGGG - Intergenic
1077163412 11:1124028-1124050 CAGGTGCATCCTCTGGCCCTGGG - Intergenic
1077929531 11:6716611-6716633 CATGTATAACCACTGGACCTGGG - Intergenic
1078000907 11:7494792-7494814 CAGCTAGAACTTCTGGGCCCAGG - Intronic
1078006960 11:7539463-7539485 CAGGTACAGCTTGTGGCCCTGGG + Intronic
1079315036 11:19400315-19400337 CAGGTAGAACCTCTGGTGGTGGG + Intronic
1080497023 11:32830122-32830144 CAAGAAGAGCCTCTGGCCCGGGG + Exonic
1081223555 11:40492949-40492971 CAGGTAGAAAAGATGGCCCTTGG - Intronic
1084493691 11:69491753-69491775 CAGGCAGAACCCCTGCCCCATGG + Intergenic
1087559874 11:99774596-99774618 CATGAAGGACCTCAGGCCCTTGG - Intronic
1088821369 11:113460467-113460489 CAGGTGGAGCCTCTGACCCCAGG - Intronic
1090485217 11:127106833-127106855 AAGGCAGGACCTCTAGCCCTGGG - Intergenic
1096339650 12:50786762-50786784 CAGGTAGGCCCTATGTCCCTGGG - Intronic
1096589332 12:52647034-52647056 AAGCCAGAACCACTGGCCCTGGG + Intronic
1097054786 12:56242929-56242951 CAGGGAGCACCCCAGGCCCTTGG - Exonic
1099033958 12:77562425-77562447 CAAGTGGAACCTCTGACCCAAGG + Intergenic
1100494155 12:95109365-95109387 CAGGAAGATCCACTGGCCTTTGG + Intronic
1102238797 12:111310805-111310827 CAGGCAAAGCCACTGGCCCTGGG - Intronic
1104170994 12:126280321-126280343 CAGGCAGTACCTCTGGAACTGGG + Intergenic
1106469661 13:30043110-30043132 GAGGTATAACCTGTGGTCCTTGG - Intergenic
1108708615 13:53012050-53012072 CAGGTAGAACTTCTGGCTGGAGG + Intergenic
1111710829 13:91812084-91812106 CAGGTAGTACCTGTTGCCTTAGG + Intronic
1112733492 13:102393738-102393760 CAGGTAGAAGCTTTGAGCCTTGG - Intronic
1113573170 13:111373174-111373196 CAGGAAGAAGCTCAGGCCCCGGG + Intergenic
1114382417 14:22221529-22221551 CAGATGGAAACTCTGCCCCTGGG - Intergenic
1115206115 14:30907027-30907049 CAGCTAGAACATTTGGCTCTGGG + Exonic
1115714881 14:36092615-36092637 GTGGTAAAACCTCTGGCTCTGGG + Intergenic
1116720574 14:48490373-48490395 GTGTTAGAACTTCTGGCCCTTGG - Intergenic
1117525859 14:56603364-56603386 CAGGTAGAATGTTTGGACCTAGG - Intronic
1121887210 14:97554427-97554449 CAGGTAGCAACACTGGCCCCAGG - Intergenic
1122852522 14:104544472-104544494 CAGAGAGACTCTCTGGCCCTGGG - Intronic
1128323164 15:66706463-66706485 CAGGTTGATCCTCTTGCCCCTGG + Intronic
1133631806 16:7629134-7629156 CAGGTAGAACCTCTGGCCCTGGG + Intronic
1136389189 16:29951619-29951641 CAGGTAGTATCTGTGGACCTTGG - Intronic
1137500774 16:49010372-49010394 CAGGCAGCAGCCCTGGCCCTTGG + Intergenic
1137633762 16:49967628-49967650 CAGGCAAAACCACTGCCCCTGGG - Intergenic
1140880875 16:79197069-79197091 CAGGTAGCTCCCCTGGCCCAAGG - Intronic
1141910961 16:87058035-87058057 CAGGGAGCACCGGTGGCCCTGGG - Intergenic
1143666040 17:8361415-8361437 CAGGAAGAAACTCAGGCCATCGG - Intergenic
1144744544 17:17605045-17605067 CAGGGAGCACCTCTGGGACTAGG - Intergenic
1147630887 17:41930776-41930798 CAGGTAGAGCCGCTCGCCTTCGG - Exonic
1150576759 17:66437586-66437608 CAGGCAGGTCCTCTGGCTCTGGG - Intronic
1151457747 17:74236639-74236661 CAGGTCTAGCCTCTGGCGCTGGG - Intronic
1152629618 17:81404797-81404819 CAGGTAGCACCTCTGTCCCCTGG + Intronic
1153250263 18:3115005-3115027 CAGTTCAAACCTCAGGCCCTTGG + Intronic
1157003879 18:43559320-43559342 CAATTAGAACCTCTGGTCCAGGG - Intergenic
1157986015 18:52438118-52438140 CAGTAAGAAACTCTGGCCCCTGG - Intronic
1162199582 19:9010709-9010731 CAGGTAGAACCTGGGGACTTTGG - Intergenic
1163630269 19:18414892-18414914 CAGATAGAGGCTCTGGGCCTGGG - Intergenic
1166897482 19:46032925-46032947 CAGGTTCATCCTCTGGTCCTGGG - Intergenic
1167749753 19:51372476-51372498 CAGGCAGAACATCAGGCCCAGGG + Exonic
1167801381 19:51744965-51744987 CAGGTAAAAACACGGGCCCTGGG + Intergenic
925126291 2:1459779-1459801 CAGGTCCAGCCTCTGTCCCTGGG + Intronic
928204301 2:29273099-29273121 CAGGTAGAAGCTCTGAGCTTGGG + Intronic
928922015 2:36536302-36536324 CAGGAAGAACCCTGGGCCCTGGG + Intronic
929165316 2:38875833-38875855 CAGTTTGGACCTCTGACCCTTGG - Exonic
929226286 2:39514743-39514765 AAGGTGGAACCTCTTGCCCAGGG - Intergenic
929667471 2:43844344-43844366 CAGGTGGAACCTCAGGGCTTTGG - Intronic
932422830 2:71611662-71611684 CATGTAGAACTTCTAGCCCCAGG - Intronic
933200746 2:79445381-79445403 GAGGTTCAACATCTGGCCCTAGG - Intronic
934657475 2:96123654-96123676 CTAGAAGAACCCCTGGCCCTAGG + Intergenic
934714239 2:96534115-96534137 TAGGAAGAAAATCTGGCCCTGGG - Intergenic
935381099 2:102451932-102451954 GAGGTAGAGACTCTGGCTCTTGG - Exonic
935610377 2:105017514-105017536 CAACTAGAATCTCTGGGCCTGGG + Intergenic
939232969 2:139454570-139454592 TAGGTCTAACCTCAGGCCCTGGG + Intergenic
941628709 2:167860117-167860139 CAACTAGAATCTCTGGCCCTTGG + Intergenic
945332987 2:208561059-208561081 TAGGTAGAACCTCTGAACATGGG - Intronic
1169235685 20:3928194-3928216 TTTGTAGAATCTCTGGCCCTGGG - Intronic
1170792816 20:19521667-19521689 CTGGAAGAACCTCAGGCCCCAGG - Intronic
1170795746 20:19545521-19545543 CAGCCACACCCTCTGGCCCTGGG + Intronic
1171990688 20:31694172-31694194 CAGGTGGCACCTGTAGCCCTTGG + Intronic
1173580046 20:44140661-44140683 CAGGGAGAACCTCTTTCCTTAGG - Intronic
1174227389 20:49013071-49013093 CAGGTAGAAACAATGGTCCTAGG - Intronic
1174384866 20:50181462-50181484 CAGCCAGAACCCCCGGCCCTGGG + Intergenic
1175966192 20:62661325-62661347 CAGATAGAGCCTCTGGGCCAGGG + Intronic
1176040097 20:63060744-63060766 CAGGAAGAAGCCCTGGCCCAGGG + Intergenic
1180177897 21:46098888-46098910 CTGGTGGAACCGCTGGGCCTGGG + Intronic
1181773222 22:25141789-25141811 AAGTCAGAACCTCTGGACCTCGG - Intronic
1183777153 22:39973738-39973760 CAGGTAGAAACTAGGGCCCGTGG - Intergenic
1185060779 22:48605655-48605677 CAGGTACAAGCTTTGGGCCTTGG - Intronic
1185258959 22:49850945-49850967 CAGATAAAACACCTGGCCCTGGG + Intergenic
950447597 3:13047324-13047346 TCAGTAGTACCTCTGGCCCTTGG + Intronic
951620348 3:24594608-24594630 CAGATAACACCTCTGGTCCTTGG + Intergenic
954290549 3:49647746-49647768 CATGTAGAATCTCTGTGCCTGGG - Intronic
954753150 3:52824822-52824844 CAGGTAGGTCCTGTGGCCCAGGG - Exonic
955968516 3:64413393-64413415 CAGGTAGAAAAGCTGGGCCTGGG - Intronic
957578010 3:82034036-82034058 CAGGCAAAACCTCTAGCCCTTGG + Intergenic
958270325 3:91491477-91491499 CAGGTGCACCCTCTGGACCTTGG + Intergenic
959154889 3:102654817-102654839 CACCTAAAATCTCTGGCCCTTGG - Intergenic
961035084 3:123636573-123636595 CAGTGCTAACCTCTGGCCCTGGG - Intronic
961454461 3:127017206-127017228 CGGGTAGAAGGTCTGGCTCTGGG + Intronic
963912880 3:150829806-150829828 CGGGGAAAACCTCTGGCTCTGGG + Intergenic
965784095 3:172318243-172318265 CCGGTAGAACCCATGCCCCTGGG + Intronic
972332855 4:38079929-38079951 AAGGTTGAATCTCTGGCCTTTGG - Intronic
972362807 4:38344502-38344524 AAGGTAGAACCTCTTCCCCAAGG + Intergenic
973613423 4:52658262-52658284 TAGGAAGAACCTCCAGCCCTTGG - Intronic
977173034 4:93786184-93786206 CAGATAGATCCTCAGGCCCCGGG + Intergenic
979764123 4:124444974-124444996 CAGGTAGAACCTTAGGCTCCTGG + Intergenic
981696936 4:147568391-147568413 CAGGTCCAGCCTCTGGCACTTGG - Intergenic
988439817 5:31220185-31220207 CAGGTAGAACCTTTGAAACTAGG - Intronic
989211974 5:38865784-38865806 CAGACAGATCTTCTGGCCCTTGG + Intronic
995708513 5:115010952-115010974 CTAGAAGAACCTCTGGCCCCAGG - Intergenic
998399284 5:141839858-141839880 CAGTTAGAAACTCTAGCTCTTGG - Intergenic
1000184704 5:158847650-158847672 AAGGTGCAAACTCTGGCCCTGGG + Intronic
1001099961 5:168806209-168806231 CAGTGGGAACCCCTGGCCCTAGG + Intronic
1001826863 5:174751939-174751961 CACCCAGAACCTCTGGTCCTGGG - Intergenic
1002176251 5:177403082-177403104 CAGGTAGAATCCCAGGGCCTGGG - Intronic
1003899784 6:10643816-10643838 AAGGCATAAACTCTGGCCCTTGG - Intergenic
1006580477 6:35074296-35074318 CAGGTAGAAAGTCTGGGCCGGGG + Intronic
1006800849 6:36758817-36758839 CAGGTAGAAACTGAGGGCCTGGG + Intronic
1006935274 6:37712907-37712929 CAGGCAGCACTCCTGGCCCTGGG - Intergenic
1008984823 6:57529878-57529900 CAGGTACACCCTCTGGACCTTGG - Intronic
1009172871 6:60422822-60422844 CAGGTACACCCTCTGGACCTTGG - Intergenic
1010184119 6:73123138-73123160 AAGTTAGAATCTCTGGCCTTGGG + Intronic
1011132167 6:84063059-84063081 CGGGAAGCACCTCCGGCCCTGGG - Intronic
1013157980 6:107511845-107511867 CAGAGACAGCCTCTGGCCCTTGG + Intronic
1014516704 6:122387738-122387760 CTGGTAAAACCTCTGCACCTGGG - Intergenic
1015744628 6:136497051-136497073 CAGGTTGAAACTCTGGCCCAGGG - Intronic
1016275744 6:142350337-142350359 CAGTTGGTATCTCTGGCCCTTGG + Intronic
1017407479 6:154135714-154135736 CATATAGAACCTCTTGGCCTTGG + Intronic
1022369132 7:29753916-29753938 CAAGTAGAACCTCTTACCATGGG - Intergenic
1023670867 7:42575272-42575294 CAGAAAGAAGCACTGGCCCTTGG + Intergenic
1024690430 7:51795520-51795542 CAGGTCCAACCTCTGGGCCATGG - Intergenic
1032639160 7:133746457-133746479 TAGGTAGAAACTCTGGCACTGGG - Intronic
1034757935 7:153640512-153640534 CAGGTGGAAGCTCTGGCTGTGGG + Intergenic
1035049566 7:155990656-155990678 CAGGTGGAAGCTCTGGAGCTGGG + Intergenic
1035075077 7:156172094-156172116 CAGGTAGAACCTTTGCCACTTGG - Intergenic
1035226681 7:157437804-157437826 CAGGAAGCAACTCTGGCCCCAGG + Intergenic
1038844098 8:31212941-31212963 CAGGCAGAAACTTTGGCTCTTGG + Intergenic
1041233259 8:55773812-55773834 CAGCCAGAACATCTGACCCTTGG + Intronic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1041738180 8:61133109-61133131 CAGGCAGAGCATCTGGCCCTTGG - Intronic
1042438455 8:68795908-68795930 CAGTGAGAACCTCTGCCCTTAGG - Intronic
1044399137 8:91750088-91750110 GAGGGAGAATCTCTTGCCCTGGG - Intergenic
1048206040 8:132416059-132416081 CTGGTAGAACCTCTAGCACCAGG - Intronic
1049685292 8:143936959-143936981 CAGGTAGAACGGCTGCCCCCAGG - Exonic
1049711810 8:144067929-144067951 CAGGTTGAACCTCCGCCTCTTGG - Intergenic
1050239204 9:3616632-3616654 CAGCCAGGACCTCTGGTCCTGGG + Intergenic
1059016262 9:110519331-110519353 CAGATAGATGCTCTGGCGCTTGG + Intronic
1059956038 9:119516791-119516813 CATGCAGAACCTCTGGGCATGGG + Intronic
1060058547 9:120437853-120437875 TTGGTAGATCCTCTGACCCTTGG - Intronic
1061722590 9:132561964-132561986 CAGGTAGAGCCTCTGCGTCTTGG + Intronic
1062031434 9:134363778-134363800 CAGGTCGCACCTCCGGCCCTGGG - Intronic
1062495256 9:136828445-136828467 GAGGTGGAACCCCTGGGCCTTGG - Intronic
1187036912 X:15549921-15549943 CCGGTAAAGCCTGTGGCCCTGGG - Exonic
1189175102 X:38948807-38948829 CATGTAGCACCTCTGCCCTTAGG - Intergenic
1190133175 X:47769286-47769308 CAGGCAGATCCTCTAGGCCTGGG + Intergenic
1191221121 X:57989549-57989571 TAGGCAGAATCTCTGCCCCTTGG + Intergenic
1191971564 X:66822747-66822769 CAGACACAACTTCTGGCCCTTGG - Intergenic
1192156920 X:68753596-68753618 CAGGTAGAAAGTCTGGAACTTGG - Intergenic
1201278652 Y:12321751-12321773 CAGGCTGAACCCCAGGCCCTGGG + Intergenic