ID: 1133631808

View in Genome Browser
Species Human (GRCh38)
Location 16:7629148-7629170
Sequence GGCCCTGGGCTGCTTCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 529}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133631804_1133631808 -5 Left 1133631804 16:7629130-7629152 CCTTCAGGTAGAACCTCTGGCCC 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG 0: 1
1: 0
2: 6
3: 51
4: 529
1133631802_1133631808 7 Left 1133631802 16:7629118-7629140 CCATGGGACATTCCTTCAGGTAG 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG 0: 1
1: 0
2: 6
3: 51
4: 529
1133631800_1133631808 22 Left 1133631800 16:7629103-7629125 CCAGATCGAAAAAGACCATGGGA 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG 0: 1
1: 0
2: 6
3: 51
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133631808 Original CRISPR GGCCCTGGGCTGCTTCTCCC TGG Intronic
900012832 1:131455-131477 GGCCCAGGGCTCCTCCTCCATGG - Intergenic
900042897 1:487442-487464 GGCCCAGGGCTCCTCCTCCATGG - Intergenic
900064334 1:722439-722461 GGCCCAGGGCTCCTCCTCCATGG - Intergenic
900090557 1:918525-918547 GTGCCTGGGCTGCTGCTCCCCGG + Intergenic
900296466 1:1954167-1954189 GGCCCGGGGCTGCTTGTCTGGGG - Intronic
900309260 1:2025451-2025473 TGCCCTGGGCTGCATGCCCCTGG + Intronic
900572037 1:3363410-3363432 GTCTCTGGGCTGCTGGTCCCTGG + Intronic
900585787 1:3431626-3431648 GGCCCGGGGCTCCCTCTCCCAGG - Intronic
901051820 1:6429153-6429175 GGCCCTGGGCAGCTTTCCCCAGG - Intronic
901228518 1:7629039-7629061 GGCCCATGGCTTCTTGTCCCAGG + Intronic
901447394 1:9316716-9316738 GGACCACGGCTGCTTCTCCAGGG + Intronic
901642710 1:10701174-10701196 GCTCCTGGGCAGCTGCTCCCTGG + Intronic
902089706 1:13893308-13893330 GGCCCGGGGCTGCTTCTCCTGGG - Intergenic
902286660 1:15411711-15411733 AGCCCTGGGCTGCCTGTGCCAGG - Intronic
902336977 1:15759328-15759350 GTCCCGGGGCTGCTCCTCTCTGG + Intronic
902482514 1:16719216-16719238 GGGCCTGGGCAGCTTTTCCCAGG + Intergenic
902566441 1:17314676-17314698 GACCTTGGGCTGCTTCTGACAGG - Intronic
902608267 1:17581486-17581508 GGCCCAGGGCTGTTTCACCCAGG + Intronic
902618870 1:17639026-17639048 GGCCCTGGGTTTCCTCTCTCTGG + Intronic
902809425 1:18879849-18879871 GGGCCTGAGCTCCCTCTCCCAGG - Intronic
903070904 1:20726663-20726685 GGCCGTGGGCAGCTTCACCCAGG - Intronic
903282170 1:22256219-22256241 GGCCCCTTGCAGCTTCTCCCAGG + Intergenic
903647647 1:24904714-24904736 GGCGCTGGGCTGGGCCTCCCTGG + Intronic
903672650 1:25045830-25045852 GCCCCTGGCCTGCTTCCCCTTGG + Intergenic
904131998 1:28282055-28282077 GGTCCTTGGCTGCTTCTGCCTGG - Exonic
904493698 1:30875332-30875354 GGCCCTGTGCACCTTCTCCTGGG + Intronic
904585128 1:31575992-31576014 TGCCCTGGGCGGCTCATCCCTGG - Intergenic
905463778 1:38137848-38137870 AGCCCTGGGGCTCTTCTCCCGGG + Intergenic
905584483 1:39105841-39105863 GGCCCTGAGCTGCTGCTTCTCGG + Intronic
906431147 1:45756736-45756758 AGCCCTGGGTTTCTTCCCCCGGG + Intergenic
906526589 1:46496838-46496860 AGCCCTGGCTTGCTGCTCCCGGG + Intergenic
907242283 1:53087509-53087531 GGCCCTGGGCTGCTCCCCTTGGG + Exonic
908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG + Intergenic
910015420 1:82517752-82517774 GGCCCGGTGCTGCCACTCCCAGG - Intergenic
910166542 1:84334178-84334200 GGTCCTGGGCTGCTTCTGGTTGG + Intronic
910935087 1:92480821-92480843 GCCCCTGCGCTGCAGCTCCCTGG + Exonic
911101443 1:94098859-94098881 TGCCCTGTGCTCCCTCTCCCAGG - Exonic
912246519 1:107965932-107965954 AGCCCTGGGCAGCTCCTGCCGGG + Intergenic
914239827 1:145846038-145846060 GACCCTGGGCCGCTCCTCCAGGG - Exonic
914781763 1:150792023-150792045 GGCCCTGGGTTGTCTCTCACCGG + Intergenic
915347915 1:155207437-155207459 GTCCCTGGGCTTCGTCCCCCTGG - Intronic
915555319 1:156657878-156657900 TGCCCTGTGCCTCTTCTCCCTGG + Intronic
918107995 1:181429674-181429696 GGCTCTGTCCTGCTTCCCCCAGG + Intronic
919840867 1:201608660-201608682 GGCCTTGGGCAGCTACGCCCTGG + Intergenic
920337307 1:205253705-205253727 TGCCCTTGGCAGCTTTTCCCAGG + Intronic
920450588 1:206058517-206058539 GGCGCTGGGCTGCTTGTCTTTGG - Intronic
921158229 1:212454294-212454316 GGCCCTGGGGTGGAGCTCCCTGG - Intergenic
921326129 1:213987737-213987759 GGCCCTGCGCTCCCCCTCCCCGG - Intronic
922261271 1:223947945-223947967 GGCCCAGGGCTCCTCCTCCATGG - Intergenic
922765741 1:228155735-228155757 GGCCCTGGGCTGATGTGCCCTGG - Intronic
922964125 1:229673886-229673908 GGACCCAGGCTCCTTCTCCCTGG - Intergenic
923286584 1:232501916-232501938 TTCCTTCGGCTGCTTCTCCCTGG + Intronic
924342434 1:243050125-243050147 GGCCCAGGGCTCCTCCTCCATGG - Intergenic
924887834 1:248239018-248239040 GGTCCTGGGCATCTTCTCACTGG + Exonic
1062768877 10:84573-84595 TGCCCTGGACTGCTGCTCCCAGG + Intergenic
1062847279 10:717747-717769 GGCCATGGGCTGCCTCTGTCCGG - Intergenic
1063219740 10:3956057-3956079 GGCCCTGGTCTGCTACCTCCTGG + Intergenic
1063339944 10:5253598-5253620 TGCTCTGGGCTACCTCTCCCAGG - Intergenic
1063343794 10:5293053-5293075 TGCTCTGGGCTACCTCTCCCAGG + Intergenic
1066500693 10:35991464-35991486 TGCCCTAGGCTGACTCTCCCAGG - Intergenic
1066734039 10:38455430-38455452 GGCCCAGGGCTCCTCCTCCATGG + Intergenic
1067048351 10:42998490-42998512 GGCTCAGGGCTGCTGCACCCAGG + Intergenic
1069620583 10:69835073-69835095 GGCCCTGTGCCCCTTCACCCAGG + Intronic
1070389460 10:75956632-75956654 GGGCCCAGGCTGCTTCTACCTGG + Intronic
1070651483 10:78240122-78240144 AGCCCTGGGATGAGTCTCCCTGG - Intergenic
1071482263 10:86073695-86073717 TGCCTTGGGCAGCTTCACCCTGG - Intronic
1072578106 10:96718764-96718786 GGCCCTGGGCTGCTGAGTCCAGG - Intronic
1072700944 10:97640937-97640959 GGCCCTGGGCCGCCGCGCCCCGG - Exonic
1072805199 10:98419555-98419577 GGCCCTGCACTGCTTCTTCTGGG - Intronic
1074772002 10:116741105-116741127 GGCTCTCCGCTGCCTCTCCCTGG + Intronic
1075119691 10:119655325-119655347 GGCTCTGGCTTGCTTCTTCCTGG - Intronic
1075576653 10:123582635-123582657 GGCCCTAGTCTGCTGCTCTCAGG + Intergenic
1075633407 10:124014996-124015018 GGCGCTCGGCTGCTTCTCCCGGG + Intronic
1076110486 10:127855843-127855865 GGCCCTGGTCTGCTATTTCCAGG - Intergenic
1076233261 10:128839358-128839380 AGCCCTGGCCTGCTTCTGACAGG - Intergenic
1076293111 10:129362727-129362749 CACCCTAGGCTGTTTCTCCCGGG - Intergenic
1076412201 10:130260072-130260094 GGCTCTTGGCTGCTTCTCCGGGG + Intergenic
1076729711 10:132432251-132432273 CCCCCGGGGCTGCTTCTCCTGGG - Intergenic
1076892783 10:133292930-133292952 TGCCCTGGGCAGCTGCTCCACGG + Intronic
1076969170 11:123659-123681 GGCCCAGGGCTCCTCCTCCATGG - Intergenic
1077074225 11:693001-693023 GGCTTTGGGCGGCTGCTCCCAGG - Intronic
1077083063 11:734078-734100 GGCCCAGGGGTCCTCCTCCCGGG - Intergenic
1077304652 11:1863718-1863740 AGGGCTGGGCTGCTCCTCCCTGG + Intronic
1077337729 11:2012891-2012913 GGCTCTGGGCTGCTGTTTCCAGG + Intergenic
1077351454 11:2095045-2095067 AGCCCTGGGAAGCTGCTCCCGGG - Intergenic
1077712870 11:4553674-4553696 TGCCCTGAGCTGTTTCACCCTGG - Intergenic
1078517632 11:12037464-12037486 GGTCCTGGGCTGCTTCTGTCTGG - Intergenic
1078665678 11:13323160-13323182 TGCCCTGTGCTCCTTCTGCCTGG - Intronic
1078696289 11:13635575-13635597 GGCCCTGGACTGCCTCAGCCCGG - Intergenic
1078934978 11:15942088-15942110 GGGCCTTGGCTGCTGCTCCAAGG - Intergenic
1079236711 11:18696295-18696317 GGCTGTGGCCTGCTTCTCCATGG - Intronic
1080456935 11:32427125-32427147 GGCCTCGCGCTGCTGCTCCCCGG + Intronic
1082888776 11:58116080-58116102 GGCCCTGGGCTGCCTATCCTCGG - Intronic
1083148717 11:60776607-60776629 GGACCTGGGCTTCGTCTCCAGGG + Exonic
1083267276 11:61552427-61552449 GGCACTGGCCTGCCCCTCCCCGG + Intronic
1083736381 11:64683836-64683858 GACCCTCGGCTGCTTCTTCCTGG - Intronic
1083928095 11:65821329-65821351 GGCCATGCTCTGCTGCTCCCTGG - Intergenic
1084657153 11:70526365-70526387 GGCCGTGGGCTGGCTCTCGCTGG + Intronic
1084660829 11:70545366-70545388 GGCCCTGGGGTGGGGCTCCCAGG + Intronic
1084666386 11:70578610-70578632 GGCCCTGGGCCACGTCTCACAGG + Intronic
1085033130 11:73284554-73284576 GCCCTGGGGCTGCTTCTGCCTGG - Intronic
1085083134 11:73649738-73649760 GGCATGGGGCTGCTTGTCCCAGG - Intronic
1088811887 11:113397761-113397783 GGCCCTGAGCTGCCTCTTTCTGG + Intronic
1089121640 11:116139822-116139844 AGCCCTGAGCTCCTTCTCCTGGG + Intergenic
1089221202 11:116873461-116873483 GGCTCTGTGCTGCTACTCACTGG + Exonic
1090402512 11:126458156-126458178 GGCCCTGGGCTGCATCTTCTGGG + Intronic
1090801348 11:130174473-130174495 GGCCCTCTGCTGCTTCTCCTGGG + Intronic
1091046606 11:132331033-132331055 GCCACTGGGCTGCTTCCCGCAGG - Intronic
1091264807 11:134262251-134262273 GGCTGTGGGCAGCTTCTGCCTGG + Intronic
1202820713 11_KI270721v1_random:68073-68095 GGCTCTGGGCTGCTGTTTCCAGG + Intergenic
1091413159 12:257565-257587 GGCTGTGGTCTCCTTCTCCCTGG - Intronic
1092241189 12:6837497-6837519 GACCCAGGCCTACTTCTCCCCGG + Exonic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1096309196 12:50505253-50505275 GGCCCCGGGCGCCCTCTCCCCGG - Intronic
1096983730 12:55743376-55743398 GGCCCTCGGCCGCCTCCCCCCGG - Exonic
1100170548 12:91970454-91970476 GGCCTTGGGCAGCTCCACCCTGG + Intergenic
1101544461 12:105698260-105698282 GACTCTGGGCTGCATGTCCCTGG - Intergenic
1101639878 12:106580455-106580477 GGCCCAGCGCTGCTTCACCTGGG - Intronic
1102010975 12:109618101-109618123 GGCGCTGGCCTGCTGCCCCCTGG + Intergenic
1103014601 12:117484239-117484261 GGCCCTGCTCTGTTTCCCCCTGG - Intronic
1103614331 12:122142557-122142579 GGCCCTGGGCTGAGTCCCCATGG - Exonic
1103700190 12:122845228-122845250 GGACCTGGCGGGCTTCTCCCGGG + Intronic
1103701141 12:122849316-122849338 GGCCTTGGCCTGGTTCTCTCTGG + Intronic
1103786369 12:123436240-123436262 GGCCCTGGGCAGCGACCCCCGGG - Exonic
1103786509 12:123436758-123436780 GGCTCAGGGCGGCTCCTCCCCGG - Intergenic
1103934080 12:124466139-124466161 CGCCCTGGCCTGCTGCCCCCCGG - Intronic
1104287001 12:127432632-127432654 AGTCCTGGGCTGCTCCTACCTGG - Intergenic
1104613491 12:130249783-130249805 TGCCCTGGGCTGCTGCTCTCAGG + Intergenic
1104783784 12:131437164-131437186 CTCCTTGGGCTGCCTCTCCCAGG + Intergenic
1104858735 12:131913940-131913962 GGCCCCTGCCTTCTTCTCCCAGG + Intronic
1104860940 12:131923220-131923242 GGCCCTGGGCTCCTGCGCCTCGG - Intergenic
1104890538 12:132137663-132137685 GGCCGTGGCCTGCGTCTCCCTGG + Exonic
1107483200 13:40802472-40802494 GGCCCTGGTTTGCTAGTCCCTGG - Intronic
1107603839 13:42040258-42040280 GGCGCTGGGAGGCGTCTCCCGGG + Intronic
1107889919 13:44905303-44905325 AGCCCTGGTCTGCTCCTCCCTGG + Intergenic
1108783978 13:53872216-53872238 GGCCCTGCAGTGCTTTTCCCTGG - Intergenic
1112495194 13:99898535-99898557 GGCTCTCGGGAGCTTCTCCCAGG + Intergenic
1112562445 13:100526416-100526438 GGTGGTGGGCTGCTTCTTCCTGG - Intronic
1112642813 13:101296019-101296041 GGCCCTGCACTGCTTCCCTCTGG + Intronic
1113286076 13:108850222-108850244 CCCCCTGGGCTTCTACTCCCTGG + Intronic
1113294316 13:108941157-108941179 TGCCCAGAGCAGCTTCTCCCTGG - Intronic
1113433070 13:110267024-110267046 TGCCCTTGGCTGCTGGTCCCTGG - Intronic
1113958134 13:114110277-114110299 GGCCCGGGTCTGTCTCTCCCTGG - Intronic
1114173272 14:20295803-20295825 GGCCCTGGAGGGCTTCTCTCGGG - Exonic
1116436261 14:44897757-44897779 GGCCCTGGGCAGCCGCGCCCGGG - Intronic
1117378958 14:55140902-55140924 TGTCCTGGGCTGCTTGGCCCTGG + Intronic
1118772614 14:68952260-68952282 AGCCCTGGGCAGCTTCTGACAGG + Intronic
1120080908 14:80215207-80215229 TGCCCTAGGCTGCTTCTCTTTGG - Intronic
1121449044 14:93996294-93996316 TGCCCAGGGCTGCCTCTCCATGG - Intergenic
1121491301 14:94363363-94363385 GGCCCTGGCCTGGCTCTCTCTGG + Intergenic
1122051885 14:99066401-99066423 CGCCCTGGGCGGCCTCACCCCGG + Intergenic
1122325947 14:100880766-100880788 CTCCCTGGGCTGGCTCTCCCAGG + Exonic
1122370746 14:101227712-101227734 TGCCCCGACCTGCTTCTCCCTGG - Intergenic
1122381857 14:101313557-101313579 TGCCCCGACCTGCTTCTCCCTGG + Intergenic
1122582551 14:102780124-102780146 AGGCCTCGGCTGCTTCTCTCTGG - Intronic
1122599065 14:102912357-102912379 GACCCTGGGGTGCTGCTCCTAGG - Intergenic
1122840860 14:104461908-104461930 GGCCCTGGACTCATTCGCCCTGG - Intergenic
1123059547 14:105588293-105588315 GGTCCAGGGCTTCTTCCCCCAGG - Intergenic
1123083886 14:105708563-105708585 GGTCCAGGGCTTCTTCCCCCAGG - Intergenic
1125501636 15:40243340-40243362 GGCCCGGTGCTGCCTCTTCCTGG + Intronic
1125757518 15:42073511-42073533 AGCCCTGGGCTGTTTCTACTGGG + Intronic
1125883215 15:43210630-43210652 GGACCTGGGTTCCTTTTCCCAGG + Intronic
1129221694 15:74135039-74135061 AGCCCTAGACTGCTGCTCCCAGG - Exonic
1129227034 15:74176068-74176090 GTCCCTGGGCAGCTGCCCCCAGG + Exonic
1129329557 15:74820120-74820142 GTCCCTGGGCTGCCATTCCCAGG - Intronic
1129362972 15:75036077-75036099 TGCCCAGCGCTGCTTCTACCAGG + Intronic
1129451314 15:75652750-75652772 GGCTCTGCACTGCTCCTCCCAGG + Intronic
1129936624 15:79456449-79456471 GCCCGTGGGCAGCTTCTCCTTGG - Exonic
1130649258 15:85752715-85752737 GGCCCTGGGCTGGTTCCAACAGG - Intergenic
1130966504 15:88701268-88701290 GGCCCAGGGGTGCCTGTCCCTGG + Intergenic
1131401367 15:92128158-92128180 GGCCCTGGGCTGCTCCTTGCTGG + Intronic
1132209336 15:100008492-100008514 GGCCCTGGCCTCCTTCCCCTTGG - Intronic
1132359402 15:101200369-101200391 GAGCCTGGCCTGCTTCTCACAGG + Intronic
1132457965 16:34788-34810 TGCCCTGGACTGCTGCTCCCAGG + Intergenic
1132609295 16:807372-807394 GGGCCTGGGCTGCTGCCTCCTGG - Intronic
1132763877 16:1524819-1524841 GGCCCGGGACCACTTCTCCCTGG - Exonic
1132941947 16:2512912-2512934 GGCCCTGGGCAGCTGCCACCAGG - Intronic
1133008445 16:2897355-2897377 AGCCCTGAGCTGTATCTCCCCGG - Intronic
1133014735 16:2934112-2934134 GGCCCTGGCCTCCTACTCCTTGG + Intronic
1133021830 16:2970199-2970221 GGCGCTGGGAGGCTCCTCCCGGG - Intronic
1133047495 16:3097118-3097140 AGCCTTGGGCAGCCTCTCCCTGG + Intronic
1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG + Intronic
1133774249 16:8885190-8885212 CGTCCTGGGCTGCTGCTTCCTGG + Intergenic
1134008982 16:10837241-10837263 TGCACTGTGCTGCTTCTCCCAGG + Intergenic
1134625795 16:15721545-15721567 GGCCTTGGTTTCCTTCTCCCTGG + Exonic
1137864223 16:51876617-51876639 GGCCCGTAGCTGCTGCTCCCTGG - Intergenic
1139331543 16:66196135-66196157 GTCCCTAGGCTGCATCACCCAGG - Intergenic
1139355810 16:66366571-66366593 GGCCCTGGCCCACTTCCCCCTGG - Intergenic
1139907401 16:70376090-70376112 TCCCCTGGGCTGCGTCTCCACGG - Exonic
1140035599 16:71369097-71369119 GGCCCTGGGCTGCTTTCTTCAGG - Intronic
1140338893 16:74138110-74138132 AGGCCAGGGCTGCTTCTGCCTGG + Intergenic
1140519218 16:75567036-75567058 GGCCCTGGGCGGCCTCATCCCGG - Intronic
1141085988 16:81096072-81096094 CCGCCTGGGCTGCTTGTCCCGGG - Intronic
1141592581 16:85078432-85078454 AGCCCTGGGCCGCTTCTCCTGGG - Exonic
1141644817 16:85361732-85361754 GGCCCTGGGCAGAGTCCCCCAGG + Intergenic
1141669662 16:85485199-85485221 GGCCCTGGGGTGCCTATCTCCGG - Intergenic
1141860751 16:86714506-86714528 TGCCCTGGGCTGGCTCTCCATGG - Intergenic
1141948164 16:87324329-87324351 GGCCCTGGGCTAATACTCCCTGG + Intronic
1142022202 16:87790803-87790825 AGGCCTGGGCTGCTCCTCTCTGG - Intergenic
1142070357 16:88088402-88088424 CGGGCTGTGCTGCTTCTCCCTGG - Intronic
1142164713 16:88580001-88580023 GCCCCTGGGTTGCTTGCCCCAGG + Intronic
1142210190 16:88804977-88804999 GGCCCAGGTCTGCTCCTTCCAGG + Intronic
1142211899 16:88812368-88812390 CGCCCTGGGCTGCTCCCTCCGGG - Intergenic
1142451505 16:90175463-90175485 GGCCCAGGGCTCCTCCTCCATGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1142752252 17:1996020-1996042 GGCCCAGGGATGCTTGTCACAGG - Intronic
1143513084 17:7406437-7406459 GGCTCGGGGCTGATTCCCCCAGG - Intronic
1143578819 17:7811856-7811878 TAACCTGGGCTGTTTCTCCCTGG + Intronic
1143738675 17:8935258-8935280 GGGTCTGGGCAGATTCTCCCTGG + Intronic
1143885218 17:10060170-10060192 GCACCAGGGCTGCTTCTCCTCGG - Intronic
1143994277 17:10993311-10993333 GTCTCTGTGCTGCTCCTCCCAGG + Intergenic
1144371244 17:14593891-14593913 AGCCCTGGGCTCCTCCTCCCAGG - Intergenic
1144726435 17:17504831-17504853 GGCTTTGGGGTGATTCTCCCCGG - Intergenic
1144875458 17:18394879-18394901 GTCCCTGCACTCCTTCTCCCAGG + Intergenic
1144959934 17:19039265-19039287 GGCCCTGGGCTGGGACACCCTGG - Intronic
1144975226 17:19135259-19135281 GGCCCTGGGCTGGGACACCCTGG + Intronic
1145156767 17:20549542-20549564 GTCCCTGCACTCCTTCTCCCAGG - Intergenic
1146626667 17:34440206-34440228 GGCCCAGGTCTGCTTTCCCCTGG + Intergenic
1147458723 17:40554831-40554853 GGACCTGGGCTGCCTCAGCCAGG - Exonic
1147630090 17:41924665-41924687 GGGCCCTGGCTGCATCTCCCTGG - Intronic
1147686193 17:42288243-42288265 GGCCCTCGGCGGCGGCTCCCAGG - Exonic
1148085722 17:44992758-44992780 AGGCCAGGGCTGCTGCTCCCTGG - Intergenic
1148161737 17:45454021-45454043 GGCCCTGCGCGCCTCCTCCCAGG - Exonic
1150224649 17:63517471-63517493 GGCTCTGGGCTGCTTCTGTTGGG + Intronic
1150229847 17:63543952-63543974 GCCACTGGGCTGCAGCTCCCTGG + Intronic
1150392971 17:64800666-64800688 GGCCCTGCGCGCCTCCTCCCAGG - Intergenic
1150455535 17:65304066-65304088 GGCTAGGGGCTGCTTCTTCCTGG + Intergenic
1151383825 17:73743200-73743222 CGCCCTTGGCTGCCCCTCCCAGG + Intergenic
1151656574 17:75499014-75499036 GCTCCTGGGCTGCCTGTCCCTGG + Exonic
1151718882 17:75844718-75844740 GGCCCAGGTCAGCTTCTCTCAGG - Intergenic
1151877865 17:76877529-76877551 GGCCCTGGGGCTCTTCTCTCAGG + Intronic
1151977943 17:77492894-77492916 GGCTCAGGGCAGCTCCTCCCGGG + Intronic
1151995050 17:77603163-77603185 GGCTCTGGGCTCTTTCTCCCCGG - Intergenic
1152162173 17:78675568-78675590 TGCGCTGGGGAGCTTCTCCCTGG - Exonic
1152645475 17:81466693-81466715 GGCCGTGGGCCGCCCCTCCCAGG - Intergenic
1152799631 17:82324720-82324742 GGCTCCAGGCTACTTCTCCCGGG - Exonic
1152885480 17:82846691-82846713 GCTCCTGGGCTGCTGCTCCGAGG - Intronic
1152892635 17:82891131-82891153 GCGACTGGGCTGCTCCTCCCAGG - Intronic
1152926124 17:83088553-83088575 GGCCCTGGGCACCTGCTCACTGG - Intronic
1152961962 18:85527-85549 TGCCCTGGACTGCTGCTCCCAGG + Intergenic
1153341593 18:3980320-3980342 GGAACTGGGCTGCTCCTCCCAGG - Intronic
1153947896 18:10032855-10032877 CGGCCTTGGCCGCTTCTCCCGGG - Intergenic
1154177290 18:12093773-12093795 GGCTCAGGGCTGTTTCTCCGCGG + Intergenic
1155509363 18:26561722-26561744 GTCCCTGGGCAGCTAATCCCTGG + Intronic
1155939937 18:31792919-31792941 GGCTCTGGGTTTCTTCTTCCTGG - Intergenic
1156344237 18:36241486-36241508 GGCCTTGGGCAGCTTCTTCATGG + Intronic
1157287188 18:46384913-46384935 GGCTCTGGGCTGTATCTACCAGG - Intronic
1157328670 18:46687441-46687463 GTCCATAGGCTGCTTCTCCTTGG + Intronic
1157696625 18:49728522-49728544 GCCCATGGGCTTCTTTTCCCAGG - Intergenic
1157807291 18:50667656-50667678 GGCCCTGGGCTGTCTCAGCCAGG - Intronic
1158695174 18:59697300-59697322 GGCCCCTGGCAGCTCCTCCCCGG + Exonic
1159577164 18:70193357-70193379 GGCCGAGGGCTGCTGCTTCCTGG + Exonic
1160242346 18:77132743-77132765 GGCCGGAGGCTGCTTCTCTCTGG + Exonic
1160299585 18:77668188-77668210 GGACCCGGCCTCCTTCTCCCTGG + Intergenic
1160431965 18:78818994-78819016 GCTCCTGGCCTGCATCTCCCTGG - Intergenic
1160645975 19:193585-193607 GGCCCAGGGCTCCTCCTCCATGG - Intergenic
1160980626 19:1815083-1815105 GGCCCAGGGCTGGCTCCCCCAGG - Intergenic
1161016932 19:1987806-1987828 GGACCTGGGCAGCCCCTCCCCGG + Intronic
1161600234 19:5177724-5177746 TGCCCTGTGCTCCTTCTCCAGGG - Intronic
1161851378 19:6739669-6739691 CGCCCTCGGCTGAGTCTCCCCGG + Exonic
1162460168 19:10810101-10810123 GGTCCTGGCCTGAGTCTCCCGGG - Intronic
1162524880 19:11201404-11201426 ATCCCTGGGCTTCTCCTCCCTGG + Intronic
1162802274 19:13118203-13118225 GGGCCGGGGCCGCTCCTCCCTGG + Intronic
1163034239 19:14562286-14562308 GGCCCAGGGCTGCTTCCCGTGGG + Intronic
1163177374 19:15573716-15573738 GGCCCTTGGCTGCCTCTACTAGG + Intergenic
1163845003 19:19633815-19633837 GGCCGTGGGATGCTGCTCCAGGG + Exonic
1164530054 19:29041729-29041751 TGCTATGGGCTGCTTTTCCCAGG - Intergenic
1164674562 19:30092850-30092872 GCTTCTGGGCTGCTCCTCCCTGG + Intergenic
1165097907 19:33419808-33419830 GGCCTGGGGCTCCTTCGCCCAGG - Intronic
1166504320 19:43361765-43361787 GGGCCTGGGCTCCTGGTCCCAGG + Intronic
1166830580 19:45637205-45637227 GGTCCTTGTCTGCTTCTCTCTGG - Intronic
1166935344 19:46329277-46329299 GGCCCTGGGTAGCTGCTCGCTGG - Exonic
1167129213 19:47573291-47573313 CGCTCTCGGCTGCTTCTCCGAGG + Intergenic
1167375128 19:49107141-49107163 GGCTCTTGGCTGCGTGTCCCAGG - Intronic
1167529050 19:50003433-50003455 GACCCTGAGCTGCTGCTCACGGG + Intronic
1168101449 19:54143588-54143610 GGCCCACAGCTCCTTCTCCCTGG - Intronic
1168403239 19:56098075-56098097 GGCCCCAGGCTCCTTCACCCAGG - Intronic
1168473436 19:56659564-56659586 GCCCCTTGGGTGGTTCTCCCTGG + Intergenic
1168571894 19:57477351-57477373 GGCCCTGGACAGCTGATCCCAGG - Exonic
925350101 2:3195091-3195113 GGTCCTTGGCTGCTCCTCGCAGG + Intronic
925600595 2:5605091-5605113 GGCCCTGGGAGGCTTCTGACAGG - Intergenic
926161563 2:10493674-10493696 GGCCCTGTGCCACCTCTCCCCGG + Intergenic
926217385 2:10913868-10913890 GGTCCTGTGGTGCTTCTCCTCGG - Exonic
926292603 2:11542572-11542594 GGCTCTGGGTTTGTTCTCCCTGG - Intronic
926996577 2:18742092-18742114 GGCCCTGGGCCCCTTCTCTCCGG - Intergenic
927207145 2:20617943-20617965 GGCGCACGGCTCCTTCTCCCTGG + Exonic
928132393 2:28662072-28662094 GGACCTGATCTGCTTCTTCCAGG + Intergenic
929644005 2:43609444-43609466 GGCCCTGGGTCGCCTATCCCAGG - Intergenic
929857897 2:45651417-45651439 GGCGCGGCGCTGCTTCGCCCAGG + Intronic
930013590 2:46956025-46956047 GGCCCTGGGCTGTGCCACCCTGG - Intronic
930948438 2:57106210-57106232 GGCACTGGTCTCCTTCCCCCAGG + Intergenic
932381868 2:71291588-71291610 TGCCTTGTGCTCCTTCTCCCTGG + Intronic
932557976 2:72842427-72842449 GGCCCTGGGCACCTTCCCCCTGG + Intergenic
932565029 2:72900801-72900823 GGCACATGGATGCTTCTCCCAGG - Intergenic
934981838 2:98849481-98849503 GGCTCAGGCTTGCTTCTCCCTGG + Intronic
934986704 2:98892905-98892927 GGCCCTGCTCTGCCTCTCCGAGG + Intronic
935403369 2:102683429-102683451 GGCCTTCGTCTGCTTCACCCTGG + Exonic
936076017 2:109402346-109402368 GGGCCTGGGCTCCCTCTCCTGGG - Intronic
936890643 2:117366098-117366120 GGTCTTGGGCAGCTTCACCCTGG + Intergenic
937244730 2:120485277-120485299 GCCCCTGGCCTGCCTCTCCTGGG - Intergenic
938163794 2:129009172-129009194 GTCCCTGGCCTGCCTCTCCCTGG - Intergenic
939835625 2:147125908-147125930 GGCCTTGGGCAGCTCCACCCTGG - Intergenic
941065189 2:160893741-160893763 GTCCCTGGGCTGCTGCTCCCTGG - Intergenic
942133961 2:172906998-172907020 GGCCTGGGGCTGCTCCTGCCTGG - Intronic
944838512 2:203603198-203603220 GGCCCAGGGCACCTTCTCTCTGG + Intergenic
946332799 2:219019675-219019697 GGAGCTGTGCTGCGTCTCCCTGG - Exonic
946907224 2:224429056-224429078 TGCCCTGGGCTGGATCTCCTGGG + Intergenic
948049520 2:234969093-234969115 AGCCCAGGGCTACTTCCCCCAGG + Intronic
948543925 2:238712032-238712054 GGCACTGGCCAGCTTCTCTCTGG - Intergenic
948798977 2:240421581-240421603 TGCCCTGGCCAGCTTCTCCTGGG - Intergenic
949069338 2:242013958-242013980 GGCCCTGACCTGCCTCTCTCTGG - Intergenic
1169048744 20:2558870-2558892 GGGCACGGGCTGCCTCTCCCCGG - Intronic
1169075667 20:2758654-2758676 GACCCCAGGCTCCTTCTCCCAGG - Intronic
1169406628 20:5326687-5326709 GGCTCAGGGCTGCATCTGCCTGG - Intergenic
1169541048 20:6600100-6600122 GGCCCTGGGATGCCTCACACTGG + Intergenic
1169853924 20:10083024-10083046 TGTCCTGGGCTGATACTCCCTGG + Intergenic
1170081722 20:12484117-12484139 GCCCTTGGGCACCTTCTCCCAGG + Intergenic
1171085717 20:22236482-22236504 GGCCCGGGGCTGGATCTCTCAGG + Intergenic
1171114719 20:22515428-22515450 GGGCCTTTGCTCCTTCTCCCAGG - Intergenic
1171484265 20:25476288-25476310 GGCCCGGGCCTGCTGCTCCGAGG + Exonic
1171511050 20:25685374-25685396 GTCCCTGGACTCCTTCTCCCAGG - Intronic
1172118324 20:32584205-32584227 GCCCCGGGGCTGCCTGTCCCGGG - Intronic
1172479087 20:35260491-35260513 GGCCCTGAACAGCTTGTCCCAGG + Intronic
1172628936 20:36365558-36365580 GGCCCTGCCCTGCCTCTTCCTGG + Intronic
1172645967 20:36469837-36469859 GGCCATCTGCTCCTTCTCCCTGG + Intronic
1173166622 20:40690523-40690545 GGCCCTGGGCCGCTTCACTGTGG - Intergenic
1173582904 20:44159970-44159992 CGCCCTCGGCGGCCTCTCCCAGG + Exonic
1173746803 20:45443860-45443882 GGCCAAGGTGTGCTTCTCCCAGG + Intergenic
1173863641 20:46300223-46300245 GGGGGTGGGCTGCCTCTCCCAGG + Intronic
1174157905 20:48528558-48528580 CGCCCTGGGATGCTCCTCTCCGG - Intergenic
1174503930 20:51004737-51004759 GTGCGTGGGCTGGTTCTCCCTGG - Exonic
1175392080 20:58633836-58633858 AGCTCTGGGCTGCTCCTCCTTGG - Intergenic
1175418792 20:58818306-58818328 AGACCTGAGCTGCTTCTCCCGGG + Intergenic
1175448170 20:59040882-59040904 GGATCAGGGCTGCTTCTCCCAGG + Intronic
1175507142 20:59494057-59494079 GGCTCTGAGCTGTTTCCCCCAGG - Intergenic
1175905388 20:62376990-62377012 GTCCCGGGGCTGAATCTCCCCGG + Intergenic
1175912572 20:62411850-62411872 GGCCATGGCCTGCGTCTGCCCGG - Intronic
1175980587 20:62736613-62736635 GGCCCTGGCCTGTGGCTCCCAGG + Intronic
1176279531 20:64292631-64292653 GGCCCAGGGCTCCTCCTCCATGG + Intergenic
1178597146 21:33964374-33964396 ATTCGTGGGCTGCTTCTCCCAGG + Intergenic
1178788626 21:35677346-35677368 GGCCCTGACCTGCTTCTCTCAGG - Intronic
1178901822 21:36604897-36604919 CACCCTGGACTGTTTCTCCCAGG + Intergenic
1179101643 21:38359797-38359819 GGGCCTTGCCTGCCTCTCCCAGG + Intergenic
1180069390 21:45428593-45428615 GGCCCAGGGCTCCCTCTCTCCGG - Intronic
1180073518 21:45450360-45450382 GGCTCTGGGCTGCCTCTCCGCGG - Intronic
1181667027 22:24405424-24405446 GTCCCTAGGCTGCTCCTACCTGG - Intronic
1182520893 22:30884014-30884036 GGCCTGGAGCTGCGTCTCCCAGG + Intronic
1183102481 22:35592494-35592516 GGCACTGGGCTGACTCTCCAGGG + Intergenic
1183356580 22:37362998-37363020 GGCCCTGGGCTGCTGTTGCCAGG - Intergenic
1183529660 22:38346604-38346626 GGCCCTGGGCCACTTCTCCTAGG + Intronic
1183593359 22:38794630-38794652 GCCCCTGGGTTCCTTCTCCAGGG - Intergenic
1183692756 22:39400049-39400071 GGCTGTGGGCTGCTGCTGCCGGG + Intronic
1183978831 22:41528091-41528113 GCCCCAGGGTAGCTTCTCCCAGG + Exonic
1183987028 22:41575590-41575612 GGCGCTGGGCTCCTTCCCCTGGG + Exonic
1184362474 22:44026623-44026645 GGCCAGGGGCTGCTCCACCCTGG - Intronic
1184474364 22:44712505-44712527 TCCCCTGTGCTCCTTCTCCCAGG - Intronic
1184511535 22:44936237-44936259 AGCCCTGGAGTGCTCCTCCCTGG + Intronic
1185292138 22:50032473-50032495 GCCCCTGGCCAGCTCCTCCCAGG + Intronic
949945618 3:9187531-9187553 AGCCCTGGGCCTCTTCCCCCGGG + Intronic
950444072 3:13026020-13026042 GGCCCGGGACTGCAGCTCCCAGG + Intronic
950961396 3:17111705-17111727 GGGCCAGGGCTGATTCACCCAGG + Intergenic
953880393 3:46688330-46688352 GGACGTGGGCTCCATCTCCCAGG + Intronic
954210749 3:49095676-49095698 GGCCCTGGGGTGTTTGTCCATGG - Intergenic
954326353 3:49866317-49866339 GTCCCTTGGCTGTTCCTCCCAGG - Intronic
954385492 3:50241814-50241836 GGCCCTGGGCAGCTTGTCAGCGG + Intronic
955035897 3:55267318-55267340 TGCCCTGCTCTACTTCTCCCTGG + Intergenic
955065582 3:55531184-55531206 GGCCTTGGCCTGCTACTCCTTGG + Intronic
955239185 3:57164803-57164825 GTCCCAGGGCTGCGTGTCCCGGG - Intronic
958052168 3:88362603-88362625 GGCCCATGGCTGCTACTGCCTGG + Intergenic
961383505 3:126510758-126510780 CGCCCTGCGCTACTTCCCCCCGG - Exonic
961580126 3:127874195-127874217 AGCCCTGGACTGCTTCTGGCAGG - Intergenic
961659723 3:128462331-128462353 GGGCCTGGGCTGTTTCTATCAGG - Intergenic
963091542 3:141487406-141487428 GGGCCGGGGCTGCTGCTCTCCGG + Intronic
963816589 3:149838148-149838170 GGTCTTGGGCAGCTCCTCCCTGG + Intronic
964381687 3:156103958-156103980 GGGCTTGGGCTGAATCTCCCTGG - Intronic
966883480 3:184362270-184362292 GGGCGTGGGTCGCTTCTCCCTGG + Intronic
968371706 3:198225941-198225963 GGCCCAGGGCTCCTCCTCCATGG + Intergenic
968525079 4:1052611-1052633 GGCCCTGCGCTGCTGTTCCTGGG + Intergenic
968576277 4:1367707-1367729 GGTCCTGCGCTGCTTCTCCAGGG + Intronic
968703697 4:2068758-2068780 GGCCCCGGGCTGAGCCTCCCTGG + Exonic
968968946 4:3783602-3783624 ACCCCAGGGCTGCTTTTCCCAGG - Intergenic
969357843 4:6641114-6641136 GGCCCTCGGCCGCGTCGCCCGGG - Exonic
969401173 4:6956633-6956655 TGCCCGGGGCTGCTTCTCTGTGG + Intronic
969455883 4:7299318-7299340 GGCCCTGGACTGCTGCTCAGTGG - Intronic
969489449 4:7490828-7490850 CTCCCAGGCCTGCTTCTCCCTGG + Intronic
969654198 4:8486889-8486911 CTCCCTGGGCTGCTCCTCGCCGG - Intronic
970605912 4:17681758-17681780 TGCCTTGGGCTGCTTCCCCATGG + Intronic
974641267 4:64633894-64633916 AGCTCTGGTCTGCATCTCCCAGG - Intergenic
974697707 4:65397181-65397203 GGCCCTGGGGTACTTCTCCCTGG + Intronic
976197658 4:82548766-82548788 GGCCCTGGGCTGGGTCTTCAGGG + Intronic
976281951 4:83334644-83334666 GGACCTGGACTTCTTCACCCAGG - Exonic
977295293 4:95202781-95202803 GCCCCTGTGCTGCTCCTCGCTGG - Exonic
977484221 4:97621644-97621666 GGCCCTGAGCTTCTTTTCACTGG - Intronic
977633077 4:99264225-99264247 AGCTCTGGTCTGCTACTCCCAGG - Intergenic
978318061 4:107462266-107462288 TTCCCTTGGCTCCTTCTCCCTGG - Intergenic
978776529 4:112511059-112511081 GGCCCTGGGCGGCTTTGGCCAGG - Intergenic
979260394 4:118638419-118638441 GGCCCAGGGCTCCTCCTCCATGG + Intergenic
980897490 4:138874168-138874190 GTCCCAGGCCTCCTTCTCCCTGG + Intergenic
981228674 4:142326899-142326921 GGCCCTGGGCAAATTATCCCAGG - Intronic
981850608 4:149225635-149225657 GAGGCTGGGCAGCTTCTCCCAGG + Intergenic
982260061 4:153487151-153487173 GTCCCTGAGCTGCCTCACCCTGG - Intronic
982843271 4:160219647-160219669 GGCCTTGGGCAGCTCCACCCTGG + Intergenic
983904712 4:173170118-173170140 GACCCTGACCTGCTTCCCCCCGG + Intronic
983972686 4:173893848-173893870 GGCCCAGGTCTGCATCTGCCTGG + Intergenic
984465773 4:180099282-180099304 GGACCTGGGCTGCTTCTGGTTGG + Intergenic
985690886 5:1311639-1311661 GCCCCGGGGCTGCTCCTGCCAGG + Intergenic
985860566 5:2467376-2467398 GGACCTGGGGTGCTTCACCTGGG - Intergenic
986451415 5:7869273-7869295 CGCCCCGGGCCGCCTCTCCCAGG - Intronic
987298402 5:16574687-16574709 GGCCCCAGGCTCCTCCTCCCAGG + Intronic
987799284 5:22672558-22672580 TGCCATGGGATGATTCTCCCTGG + Intronic
990448987 5:55917982-55918004 GGCCCTGCCCTGCTGCTTCCGGG - Intronic
996253139 5:121363229-121363251 GCTCCTGGGCTACTTCACCCAGG + Intergenic
997474474 5:134134599-134134621 GGCCCTTGGCTCCTTCTCCCTGG + Intronic
997642760 5:135460318-135460340 GGCCCTGGGCTGCTCACACCTGG - Intergenic
997774173 5:136584531-136584553 GTTCCTGGGTTGCTACTCCCTGG - Intergenic
998182341 5:139954265-139954287 GGCCCCAGGCTGCTCCTCTCTGG - Intronic
998449469 5:142223005-142223027 GGCGCTGGAGTGCTCCTCCCTGG - Intergenic
999250656 5:150180403-150180425 GTTCCTGGGCAGCTTTTCCCTGG - Intronic
999333873 5:150698361-150698383 TGCCGTGGTCTGCTTTTCCCAGG - Intronic
1001823138 5:174725148-174725170 GGCCCTGGGCTTGCTTTCCCGGG - Intronic
1002175081 5:177397046-177397068 AGCGCTGGACAGCTTCTCCCTGG - Exonic
1002329647 5:178432778-178432800 GGCCCTGGGGCACTTGTCCCAGG - Intronic
1002418940 5:179135516-179135538 GGCACTGGGCAGCTTCTTGCTGG - Intronic
1002427724 5:179185915-179185937 CGGCCTGGCCTCCTTCTCCCTGG - Intronic
1002577472 5:180182882-180182904 GGCCCTGGATTCCTACTCCCTGG + Intronic
1002586300 5:180250878-180250900 GAATGTGGGCTGCTTCTCCCTGG - Intronic
1002730946 5:181331487-181331509 GGCCCAGGGCTCCTCCTCCATGG + Intergenic
1002753587 6:142617-142639 GGCCCAGGGCTCCTCCTCCATGG - Intergenic
1002880004 6:1242840-1242862 AGGGCTGTGCTGCTTCTCCCAGG + Intergenic
1003072893 6:2958583-2958605 GGCGCTGGGCGTCTTCTCCGTGG - Intronic
1003098517 6:3159702-3159724 GTCCCTCGGATGCTACTCCCAGG + Intergenic
1003144204 6:3495965-3495987 GGCCCAGGGCTGTGTCCCCCAGG + Intergenic
1003989285 6:11469960-11469982 GGCCCTGCTGTGCCTCTCCCTGG + Intergenic
1004254536 6:14050799-14050821 GGGCTTGAGCTGCTTCTCCTGGG + Intergenic
1005636039 6:27754186-27754208 CCCCCTGGTCTGCATCTCCCTGG - Intergenic
1005813340 6:29532150-29532172 GGGGATGGGCTGCTTCTCCCTGG + Intergenic
1005848525 6:29801326-29801348 GGCCCTGGGCTTCTACCCTCTGG + Intergenic
1006148172 6:31971513-31971535 GGAACTGGGCTGCTTCTCCCTGG - Exonic
1006181182 6:32154269-32154291 GGGCCTGGGCTGCTGCTCACGGG + Exonic
1006986390 6:38178514-38178536 GCCCTGGGGCTCCTTCTCCCTGG - Intronic
1007094509 6:39205073-39205095 TGCCCTGGGCTTGTTCTCACAGG - Intronic
1007414147 6:41682418-41682440 GCCCCTGGGCTCCTTCAGCCTGG - Intergenic
1007686849 6:43672121-43672143 GGCCCTGGGCTGCCTGAACCTGG - Exonic
1007689187 6:43687730-43687752 GGCTGTGGGCGGCTTCTCCGTGG - Exonic
1010703197 6:79077460-79077482 GGTCCTGGGATGCTCCTTCCCGG + Exonic
1014163634 6:118199001-118199023 TGCCCTGGGCAGCTTTTCCCAGG - Intronic
1015964142 6:138681556-138681578 GGCACTAGCCTGCTTCTCCCAGG - Intronic
1016682875 6:146850960-146850982 GGGCATGGGCAGCTTCTGCCAGG + Intergenic
1017996265 6:159534167-159534189 CCCACTGGGCTGCTTCTGCCTGG - Intergenic
1018235395 6:161718609-161718631 GCCACTGGGCTGTTTCTCTCGGG - Intronic
1018380685 6:163255544-163255566 GGCCCAGGTCTCTTTCTCCCTGG - Intronic
1018612852 6:165661470-165661492 GGCCCTGGCCTCCCTCACCCCGG + Intronic
1018732037 6:166658616-166658638 TGCCCTGGGCTGGCTCTGCCAGG - Intronic
1018808316 6:167278313-167278335 GGCCTTTGGCTGCTTCTCTGTGG - Intronic
1018988062 6:168652897-168652919 ACCCCTGGGCTGCTCCTTCCTGG - Intronic
1018989567 6:168663181-168663203 GCCCCTGGGGTGCTTCTCAGAGG + Intronic
1019322209 7:420891-420913 TGCCCAGGGCTGCTGCTCCCCGG - Intergenic
1019443906 7:1061081-1061103 GGCACTGGGCTGCCTCTGCCCGG + Intronic
1019446944 7:1076289-1076311 CTCCCTGGCCTGCCTCTCCCTGG - Intronic
1019555756 7:1630394-1630416 GGAGCTTGCCTGCTTCTCCCTGG + Intergenic
1019622809 7:2000881-2000903 GCCGCTGGGCAGCTTCTTCCAGG + Intronic
1019696978 7:2451558-2451580 GGCCCTGGGCATCTTCCACCAGG + Intergenic
1019733081 7:2638119-2638141 CCCTCTGGGCTGCCTCTCCCTGG + Intronic
1019735169 7:2646876-2646898 CGCCCTGGCCTGCCTCGCCCTGG + Exonic
1020011049 7:4805911-4805933 GGCACTGGCCGGCCTCTCCCTGG - Intronic
1020074389 7:5248302-5248324 GGCCCCCGGCTCCTCCTCCCGGG - Intergenic
1020078419 7:5273794-5273816 GGTCCTGGGCCGCTGCTCCCAGG + Intergenic
1020261478 7:6532815-6532837 GACCCTGGGCGTCTGCTCCCTGG - Intronic
1021969222 7:25950924-25950946 GGCAGTGGGCTGCGTCCCCCGGG + Intergenic
1023089536 7:36604726-36604748 AGCCCTGGACTGCTTCCCTCTGG + Intronic
1023715441 7:43039347-43039369 GGCCCTGGGCTTCCTCTCTATGG - Intergenic
1023819673 7:43973504-43973526 GGCACAGGGCTGCCTCTCTCTGG + Intergenic
1023842854 7:44106717-44106739 GGCCTTGGGTGGCTTCTCCTTGG - Exonic
1024010018 7:45259359-45259381 GGCCCCTGCCTGCTCCTCCCAGG + Intergenic
1024076089 7:45818649-45818671 GGCCCAGGGCTCCTCCTCCATGG + Intergenic
1024088201 7:45914680-45914702 GGCCCTGAGCTGCAGCTCCTGGG + Intronic
1024450536 7:49536944-49536966 GGCCCTGGGCTTTTTCTCTTTGG - Intergenic
1024647513 7:51382641-51382663 GGCCCAGGGCTCCTCCTCCATGG - Intergenic
1025004606 7:55344314-55344336 GTCCTTGGGCTTCTTCTCCTTGG - Intergenic
1025051347 7:55737136-55737158 GGCCCAGGGCTCCTCCTCCATGG - Intergenic
1025060115 7:55798391-55798413 GGCCCAGGGCTCCTCCTCCATGG - Intronic
1025128314 7:56362803-56362825 GGCCCAGGGCTCCTCCTCCATGG - Intergenic
1025176697 7:56805684-56805706 GGCCCAGGGCTCCTCCTCCATGG - Intergenic
1025198162 7:56947567-56947589 GGCCCTGGGCTGCCTTCCCCGGG - Intergenic
1025200474 7:56958399-56958421 GGGCCTGGGCCGCTGCTCTCAGG - Intergenic
1025671470 7:63618533-63618555 GGGCCTGGGCCGCTGCTCTCAGG + Intergenic
1025673787 7:63629369-63629391 GGCCCTGGGCTGCCTTCCCCGGG + Intergenic
1025695095 7:63770702-63770724 GGCCCAGGGCTCCTCCTCCATGG + Intergenic
1025991730 7:66502737-66502759 GGCCAGGGGCTGCTGCTGCCTGG + Intergenic
1026471076 7:70694472-70694494 GGCGCGCGGCGGCTTCTCCCCGG - Intronic
1026931367 7:74224646-74224668 GGCCAGGGGATGCTTCTCTCTGG - Exonic
1027256410 7:76433507-76433529 GGAGGTGGGCTGCATCTCCCAGG - Exonic
1027670661 7:81092622-81092644 GGCCCTGCCCTACTTCTCCTTGG + Intergenic
1029193989 7:98791528-98791550 GGCCCTGGGGTCCATCTACCTGG + Intergenic
1029744722 7:102510473-102510495 GGCACAGGGCTGCCTCTCTCTGG + Intronic
1029762713 7:102609635-102609657 GGCACAGGGCTGCCTCTCTCTGG + Intronic
1031341141 7:120603546-120603568 TGCCCTATGCTACTTCTCCCTGG - Intronic
1032052624 7:128658412-128658434 GGCCCAGGGCTCCTCCTCCATGG + Intergenic
1032077565 7:128843298-128843320 GGCCCTGGGCTGAATCGCACAGG + Exonic
1032087373 7:128891151-128891173 ACCCCTCGGCTGCTCCTCCCTGG - Intronic
1033159047 7:138981127-138981149 CGCCCGGGGCTGCTGCTTCCTGG - Exonic
1033588854 7:142794139-142794161 GCCCCTGAGCTGCTTCTTTCAGG + Intergenic
1034195128 7:149240293-149240315 CAGCCTGGGCTGCTTCTCCTTGG + Intronic
1034445738 7:151113379-151113401 AGTCCTGGGCTGGATCTCCCAGG - Intronic
1034563586 7:151896673-151896695 GCCCCAGGGTGGCTTCTCCCTGG + Intergenic
1035257142 7:157637666-157637688 CCCTCTGGGCTGCTTCTCCTGGG - Intronic
1035460211 7:159034026-159034048 GGCCCTGGACAGCATTTCCCTGG - Intronic
1035529745 8:341765-341787 GCCGCGTGGCTGCTTCTCCCTGG - Intergenic
1035743804 8:1947328-1947350 AACCGTGGGCTGCTTCGCCCCGG - Intronic
1035990425 8:4483988-4484010 GGCAATGGGATGTTTCTCCCAGG - Intronic
1037820654 8:22133282-22133304 GGCCGGGGGCTGCTCCGCCCGGG - Intronic
1039354001 8:36795225-36795247 GGGCCTGGGCTCCTTCCCCCTGG + Intronic
1040386672 8:46918964-46918986 GGCCCTGGGTTCCTTCCCACAGG + Intergenic
1041098984 8:54377952-54377974 TGCCCAGTCCTGCTTCTCCCTGG + Intergenic
1042040094 8:64580970-64580992 GCCCCTGGGCTGCTTCGAGCCGG + Exonic
1042040690 8:64585741-64585763 CGCCTTGGGGTGCTTCTCTCAGG + Intergenic
1042393384 8:68262117-68262139 GGACCTGGGCTCCGTCACCCAGG - Intergenic
1042533264 8:69835075-69835097 CGCCCTCGGCTGCTCCTCTCCGG - Intergenic
1042567165 8:70123853-70123875 GCCACTGGGTTGCTTCTCCTTGG + Intronic
1045356187 8:101391098-101391120 GGCCCTGGAGTCCTTCTCACTGG + Intergenic
1048898343 8:139015104-139015126 GGCTGTGGGCAGCTCCTCCCTGG + Intergenic
1049205644 8:141362266-141362288 CTCCCTGGGCTGCCTCTCTCTGG + Intronic
1049240900 8:141536962-141536984 GGCCCTGGGCTGCTCTCCTCTGG + Intergenic
1049276676 8:141723525-141723547 ACCCCTGGCCTGCTTCTCTCTGG - Intergenic
1049324676 8:142015799-142015821 GGCCTCAGGCGGCTTCTCCCAGG - Intergenic
1049372614 8:142274944-142274966 GGCCCTGGGCTCAGGCTCCCTGG - Intronic
1049382422 8:142323990-142324012 CGCCCTGGACTGCTTCAGCCAGG + Intronic
1049385691 8:142341921-142341943 GGCTGTGGGCTGCTTGTCTCTGG - Intronic
1049425236 8:142535241-142535263 GGCCCTGGGCTCTGCCTCCCTGG - Intronic
1049540880 8:143208220-143208242 TGCCCTGGGCTGCACCTCTCTGG + Intergenic
1049545049 8:143226661-143226683 AGCACAGGGCTGCCTCTCCCAGG + Intergenic
1049570900 8:143369848-143369870 GTCCCTGGGCTGGTTCTACTCGG + Intronic
1049604889 8:143524732-143524754 GGCCCTGGCCTTCAGCTCCCCGG + Intronic
1049910807 9:265711-265733 AGCCCTGGAAGGCTTCTCCCTGG - Intronic
1049993990 9:1017484-1017506 GCCCCTGGACTGCTGATCCCTGG + Intergenic
1050820350 9:9871673-9871695 GCCCCTGCACTTCTTCTCCCAGG - Intronic
1053278695 9:36802379-36802401 AGCCCCAGGCTGGTTCTCCCCGG - Intergenic
1055128631 9:72749533-72749555 TGCACTGGTCTGCTTCTCCTAGG - Intronic
1056245562 9:84691685-84691707 GTCACAGGGCTGCTTCCCCCAGG - Intronic
1056707585 9:88965227-88965249 GGCCCTGGGCTTCTTTTCTTGGG - Intergenic
1056799024 9:89678541-89678563 GGGCCTGGGCTTCTGCACCCCGG - Intergenic
1056942525 9:90967474-90967496 CGCCCAGAGCTGCTTCTACCAGG + Intergenic
1057194892 9:93111434-93111456 GGGACTGGGCGGCTTGTCCCAGG + Intronic
1057261269 9:93586155-93586177 GGCCATGGGGTCCCTCTCCCCGG - Intronic
1058680784 9:107438569-107438591 TGCCTTGGGCTGTTTGTCCCTGG - Intergenic
1059858204 9:118425509-118425531 TGCCTTGGGCTTGTTCTCCCTGG - Intergenic
1060407570 9:123380453-123380475 GGCCCTGAGCCCCTTCTCCAGGG - Exonic
1060533100 9:124360377-124360399 GGGCCTGGGCAGCATCTGCCCGG + Intronic
1060818500 9:126648383-126648405 GAGCCTGGCCTGGTTCTCCCAGG - Intronic
1060826425 9:126690581-126690603 GGCCCTGAGCTGCCACGCCCGGG + Intronic
1061242611 9:129383302-129383324 GTCCCTGCGCTGCGGCTCCCGGG - Intergenic
1061398323 9:130355276-130355298 GACCCTGGGCTGGGTCACCCAGG + Intronic
1061582066 9:131544350-131544372 GGCCCAGGGCTACAACTCCCAGG + Intergenic
1061778995 9:132984820-132984842 TGCCCAGGCCTGCTTCCCCCTGG - Intronic
1061973650 9:134057698-134057720 GACCCTGGGCTTCCTGTCCCAGG + Intronic
1062363319 9:136197633-136197655 AGCCCTGGGCAACTTCTCCCTGG - Exonic
1062473187 9:136715088-136715110 TGCCCAGGGCAGCCTCTCCCTGG + Intronic
1062549587 9:137079826-137079848 GGCCTGTGCCTGCTTCTCCCTGG + Intronic
1062610606 9:137371721-137371743 GGCCCGGGGGTGCTTGGCCCAGG - Intronic
1062614063 9:137388128-137388150 AGAGCTGGGCTGCTTCTCTCTGG + Intronic
1062674421 9:137732102-137732124 CGCCCTGGCCTGCAGCTCCCAGG + Intronic
1062680346 9:137775741-137775763 TGCCCTGGGCTGTTTCTGCTGGG + Intronic
1062736182 9:138138590-138138612 TGCCCTGGACTGCTGCTCCCAGG - Intergenic
1062755352 9:138283994-138284016 GGCCCAGGGCTCCTCCTCCATGG + Intergenic
1203579265 Un_KI270745v1:28166-28188 GGCCCAGGGCTCCTCCTCCATGG + Intergenic
1187242062 X:17522519-17522541 GGCCCTGGGCTGCTTCCGGATGG - Intronic
1188536223 X:31199997-31200019 GGCCCTGGCATGCTTTTCCTCGG - Intronic
1189478647 X:41376344-41376366 GGTCCTGGGATGCTGCTCACAGG - Intergenic
1190054949 X:47175931-47175953 GCCCCAGGGCTGCCTCTGCCGGG - Intronic
1190218672 X:48496725-48496747 GGCCCTCGGCAGGCTCTCCCAGG + Intergenic
1190302635 X:49065458-49065480 GCCCCATGGCTGCTTCTCTCTGG + Exonic
1191715844 X:64192971-64192993 GGCCATGGGCTGCTTCACTCAGG + Exonic
1191840956 X:65513377-65513399 GGCTCTGCCCTCCTTCTCCCTGG + Intronic
1192148808 X:68699179-68699201 GGCCCTTGGCTGCTTCCCACAGG - Intronic
1192321116 X:70091569-70091591 GGGCCTTGGCTGGTTCCCCCTGG - Intergenic
1194031470 X:88821459-88821481 GGCCCTGGGCTTTTTCTGGCTGG + Intergenic
1194114212 X:89875222-89875244 GGACCTGGTCTGCTTCTACTAGG + Intergenic
1196456119 X:115892805-115892827 GGCCCTGAGCTGATGCTTCCTGG + Intergenic
1198051860 X:132958266-132958288 GGACCTGGGCTCCCTCTGCCGGG - Exonic
1198321391 X:135521515-135521537 TCCCCGGGGCTGCTCCTCCCCGG - Intronic
1199561978 X:149172679-149172701 GACCCTGGGCTGCTTTTTCATGG + Intergenic
1199746428 X:150774660-150774682 TGCCCTGGGCTCCTTGTTCCAGG + Intronic
1200068960 X:153518380-153518402 GGCCCCGGGCGGCTTCTCGTGGG - Intronic
1200153888 X:153965070-153965092 GGGCCTGTGCTCCTCCTCCCTGG + Intronic
1200466952 Y:3530589-3530611 GGACCTGGTCTGCTTCTACTAGG + Intergenic
1202381873 Y:24280788-24280810 GGCCCAGGGCTCCTCCTCCATGG + Intergenic
1202488911 Y:25389337-25389359 GGCCCAGGGCTCCTCCTCCATGG - Intergenic