ID: 1133635412

View in Genome Browser
Species Human (GRCh38)
Location 16:7660572-7660594
Sequence CCTAGGTTATATTCTAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133635412_1133635419 28 Left 1133635412 16:7660572-7660594 CCTCCATTAGAATATAACCTAGG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1133635419 16:7660623-7660645 TAAAGTAAAATAACACTTGGAGG 0: 1
1: 0
2: 2
3: 35
4: 420
1133635412_1133635418 25 Left 1133635412 16:7660572-7660594 CCTCCATTAGAATATAACCTAGG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1133635418 16:7660620-7660642 ATGTAAAGTAAAATAACACTTGG 0: 1
1: 0
2: 6
3: 49
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133635412 Original CRISPR CCTAGGTTATATTCTAATGG AGG (reversed) Intronic
902564754 1:17304105-17304127 CCTAGGTTAGCTTCTAAGCGAGG + Intergenic
905642521 1:39601032-39601054 TCTGTGTTATATTATAATGGTGG - Intergenic
907740656 1:57162609-57162631 CCTTGGATTTTTTCTAATGGAGG - Intronic
909272223 1:73637836-73637858 CAGAGCTTATATTCCAATGGAGG - Intergenic
910200788 1:84696347-84696369 CTGAGTTTATATTCTAGTGGAGG - Intergenic
910675603 1:89813614-89813636 CCTAAATTATATTCTAATTAAGG - Intronic
910875119 1:91871459-91871481 CATAGGTTACCTTCTAAAGGTGG + Intronic
911152353 1:94607893-94607915 AGGAGTTTATATTCTAATGGAGG - Intergenic
911199641 1:95031779-95031801 TGTAAGTTATGTTCTAATGGAGG - Intronic
911948107 1:104137362-104137384 CCAAGGCTATATTCTAAGGGAGG + Intergenic
913312218 1:117511839-117511861 TGTAGTTTATATTCTAATTGGGG - Intronic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914384986 1:147159979-147160001 CCTACTTTAAATTCTAATGTTGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915375779 1:155393957-155393979 CGGAGATTATAATCTAATGGAGG + Intronic
916795802 1:168165945-168165967 CCTGGGTCATGTTCTCATGGTGG + Intergenic
917587456 1:176442184-176442206 CTTAGGCTTTATTCTACTGGAGG + Intergenic
918642633 1:186861710-186861732 CCTATGTGAAATTCTAATGTTGG + Intronic
1064349610 10:14565210-14565232 CATAGCTTATTTTCTACTGGGGG + Intronic
1067150596 10:43729456-43729478 CTCAGGTTCTATTCTAGTGGTGG + Intergenic
1067188109 10:44047265-44047287 CCTATTTTATATTATATTGGCGG - Intergenic
1068045819 10:51884844-51884866 CCTAGGTCACATTCAAAGGGAGG + Intronic
1071393936 10:85203066-85203088 CCTAAAATATATTCTACTGGAGG - Intergenic
1071920997 10:90350230-90350252 GCTTGGGTATCTTCTAATGGAGG - Intergenic
1072024177 10:91437499-91437521 CCTGGCTTATATTCAAAGGGAGG + Intronic
1072563276 10:96596477-96596499 CCTAGGTTTTATTATTATGTAGG - Intronic
1073791508 10:106944744-106944766 GCGAGTTTATATTTTAATGGTGG + Intronic
1074460856 10:113635727-113635749 CCTTGGTTAAATTCTAAAAGAGG - Intronic
1079978307 11:27120923-27120945 TATAGCTTATACTCTAATGGGGG + Intronic
1085948240 11:81298080-81298102 CCTAGGTCATACGCTAATGCTGG + Intergenic
1086901112 11:92368688-92368710 CTCAGGTTATATTCATATGGTGG + Intronic
1093149119 12:15601157-15601179 TCTAGTTTACATTCTAATAGGGG + Intergenic
1093479229 12:19587505-19587527 CCTAGATGATATTGTAAAGGAGG + Intronic
1093576177 12:20732736-20732758 TCTAGGTTATAGATTAATGGTGG - Intronic
1094543413 12:31381189-31381211 CATAGTTTATATTCCAGTGGAGG - Intergenic
1095577978 12:43760839-43760861 TGGAGTTTATATTCTAATGGAGG - Intronic
1096163116 12:49397426-49397448 CCTAGCTTACAGTCTAATGGAGG - Intronic
1096350407 12:50894313-50894335 GTGAGGTTATATTCTCATGGTGG - Intergenic
1096642394 12:53005050-53005072 AAGAGGTTATATTCTAGTGGGGG - Intergenic
1098267713 12:68739310-68739332 TGAAGGTTATATTCTAATGAGGG - Intronic
1098443705 12:70544921-70544943 CAGAGGTTACATTCTCATGGAGG + Intronic
1101494320 12:105239200-105239222 TGGAGTTTATATTCTAATGGAGG + Intronic
1106753067 13:32794747-32794769 ACTAAGCCATATTCTAATGGAGG - Intergenic
1106955173 13:34929628-34929650 TGTAGCTTATATTCTAATAGAGG - Intergenic
1107515322 13:41123458-41123480 CCTCATATATATTCTAATGGAGG + Intergenic
1108161153 13:47641098-47641120 CATAGGTTATTTTCCAGTGGGGG + Intergenic
1108756578 13:53510348-53510370 CCAAGGTTATATACTAATAAGGG + Intergenic
1114869664 14:26640922-26640944 CCTAGGTTTTCTTCTAGGGGAGG + Intergenic
1115680936 14:35737405-35737427 CCTAGGTTATATACCAAAAGTGG - Intronic
1117970956 14:61250381-61250403 CCTAGATAATATTCTATTGTCGG - Intronic
1120536943 14:85708065-85708087 TCGAGCTTATATTCTAGTGGAGG + Intergenic
1121906439 14:97750474-97750496 CCCAGGTTATGTACTGATGGGGG + Exonic
1128075789 15:64824544-64824566 CCCAGGGCATATTCTAAGGGTGG - Intronic
1133635412 16:7660572-7660594 CCTAGGTTATATTCTAATGGAGG - Intronic
1134781990 16:16906701-16906723 CCTAGTTTATAATCTAGTGGGGG + Intergenic
1135189040 16:20339769-20339791 CACAGCTTATATTCTAAAGGGGG - Intronic
1135233689 16:20734913-20734935 CATAGGTTATATACTAGTGCTGG + Exonic
1137306663 16:47207385-47207407 GCTCTCTTATATTCTAATGGAGG + Intronic
1137495697 16:48967538-48967560 CCAAGGTTATATTTTAGTGAGGG + Intergenic
1137668421 16:50265571-50265593 CCTAGGTTATATCCTTGAGGAGG - Intronic
1150169089 17:62973069-62973091 CCTAGGCTAGAGTGTAATGGCGG + Intergenic
1155574819 18:27232838-27232860 CTTTGGTTATATTTTAATGAAGG + Intergenic
1155578756 18:27279479-27279501 CCTAGGTTATTTTCTTTTGTCGG + Intergenic
1156749184 18:40429918-40429940 CCTATGTTGTCTTCCAATGGTGG - Intergenic
1166539950 19:43598705-43598727 GCTAGGTTCTATGCTAATGCTGG - Intronic
929311602 2:40432285-40432307 CAGAGCTTATATTCTAATGGTGG + Intronic
932227239 2:70052076-70052098 TGGAGCTTATATTCTAATGGAGG + Intergenic
932992919 2:76810353-76810375 ATTAGGTTATATTCTTTTGGTGG - Intronic
937673368 2:124562420-124562442 CCTAAGTAATTTTCTAATGTTGG + Intronic
939164279 2:138623251-138623273 CCAAGGTTAAATTCTAACAGTGG + Intergenic
1174056834 20:47803893-47803915 CCTGGATTCTATTCTAATGGTGG + Intergenic
1174945731 20:54983349-54983371 CCTAGGTTATAAACAAATTGAGG + Intergenic
1182233303 22:28855452-28855474 AATAGTTTATATTCTAACGGAGG + Intergenic
1183046375 22:35223795-35223817 CCTGGGTTACATTTTGATGGAGG - Intergenic
950535322 3:13574958-13574980 CCTCGTTTAGAGTCTAATGGGGG - Intronic
950961107 3:17108957-17108979 TGGAGGTTACATTCTAATGGGGG + Intergenic
953345977 3:42175952-42175974 CGTAAGTTTTATTCTATTGGGGG - Intronic
953399710 3:42601904-42601926 TATAGTTTATATTCTATTGGGGG + Intronic
953432821 3:42853788-42853810 CCTAGATTGTATTTTAAAGGAGG + Intronic
959426305 3:106193139-106193161 CGGAGTTTATATTCTAATGGAGG - Intergenic
963458050 3:145572516-145572538 TCAAGCTTACATTCTAATGGGGG + Intergenic
964093274 3:152900815-152900837 CCTAGGTTTTATTCTGCTGTTGG - Intergenic
965293255 3:166910524-166910546 CCTTGCTTATATACTAATGCTGG - Intergenic
970328312 4:14952181-14952203 CCTAAGTTATTTTCTGGTGGAGG - Intergenic
976074799 4:81285370-81285392 AGAAGGTTATATTCTACTGGGGG - Intergenic
976489465 4:85652416-85652438 CCTAACTTATACTCTAATGATGG - Intronic
977124536 4:93148798-93148820 CCTAGGGCATATCCTAATTGTGG + Intronic
977468157 4:97408081-97408103 CATAAGCTATATTCTCATGGTGG + Intronic
981138415 4:141238832-141238854 CATAGTTTATAATCCAATGGTGG - Intergenic
981837916 4:149076894-149076916 TGGAGCTTATATTCTAATGGAGG - Intergenic
985740900 5:1616825-1616847 ATTAAGTTATATTCTAAGGGGGG + Intergenic
988812891 5:34802654-34802676 CCAAGCTTATATTCTCATGGGGG + Intronic
989212279 5:38867752-38867774 CCTAGGTTAAATTTTAATGAGGG + Intronic
989480075 5:41920500-41920522 CAGAGCTTATATTCTAGTGGAGG + Exonic
992296239 5:75329620-75329642 CCTAGATTATTTCTTAATGGTGG + Intergenic
993774370 5:91972654-91972676 TCTGGTTTATATACTAATGGAGG + Intergenic
999844795 5:155467570-155467592 CGAAGCTTATATTCTAATGGGGG - Intergenic
1001538470 5:172518278-172518300 CCTAGGGTAAATTCCACTGGTGG - Intergenic
1005295369 6:24420549-24420571 CGTAGGTTATATTGTAGTGGAGG + Intronic
1005367512 6:25094047-25094069 CCAAACTTATATTCTAATTGGGG - Intergenic
1007402549 6:41611824-41611846 CCTGGGTGATACTATAATGGTGG + Intergenic
1009484300 6:64200233-64200255 TCTGCATTATATTCTAATGGTGG + Intronic
1020415610 7:7942287-7942309 CCTAGTTTATATCCTAGTGGGGG - Intronic
1020908792 7:14101869-14101891 CCTAGGTTTTATTGTATTTGAGG + Intergenic
1021150725 7:17147820-17147842 CAGAGTTTATATTCTAACGGGGG - Intergenic
1022860712 7:34363703-34363725 CTTAGTCTATATTTTAATGGGGG + Intergenic
1025236176 7:57236303-57236325 CCTGGATTCTATTCTAAGGGTGG - Intergenic
1027567056 7:79808211-79808233 TCAAGCTTAAATTCTAATGGAGG - Intergenic
1027669374 7:81076996-81077018 CCTGGGATATGTTCTAATGAAGG + Intergenic
1034399577 7:150853165-150853187 TCTGTGTGATATTCTAATGGTGG + Intronic
1037412591 8:18614259-18614281 TCAAGGTTTTATTCTAATGCTGG - Intronic
1037652485 8:20851567-20851589 CCTAGATTATATTCTACTCATGG + Intergenic
1047145323 8:122192263-122192285 TCTAGGTTATATCCTTATGGAGG + Intergenic
1047343657 8:124006555-124006577 CCAAGGTGACATTTTAATGGGGG - Intronic
1047976595 8:130136715-130136737 CCTAGATTCTATTCTATTGCTGG + Intronic
1051843761 9:21428593-21428615 CAAAGGTTACATTGTAATGGGGG - Intronic
1051936865 9:22453335-22453357 TATAGGTTATATTATCATGGAGG + Exonic
1059225506 9:112669289-112669311 CCTGGGTTATATTTTAAAGGTGG + Intronic
1062176921 9:135168534-135168556 CGTATGTTATTTTCTGATGGAGG - Intergenic
1186565015 X:10653016-10653038 TTCAGTTTATATTCTAATGGAGG - Intronic
1188752639 X:33923011-33923033 TCAAGGTCATATTCTAAGGGAGG - Intergenic
1188786564 X:34353685-34353707 CAGAGATTATAGTCTAATGGAGG + Intergenic
1189606134 X:42680024-42680046 CCTGGGTTATATTTATATGGTGG + Intergenic
1189643205 X:43096908-43096930 ACTAGGTTATTTTCTAAAAGTGG - Intergenic
1193219565 X:78907536-78907558 CCTAGGTTTTATTTTATTTGGGG + Intergenic
1193936984 X:87635558-87635580 TCTAGATTATATGCTATTGGTGG + Exonic
1194147560 X:90281785-90281807 TCAAGGTTATATTCGAAGGGAGG - Intergenic
1195739361 X:108047338-108047360 CTTAGGTTAAATTCTAATTCAGG + Intronic
1195809235 X:108811992-108812014 CCTGGGTTATATTCTGCTGCTGG - Intergenic
1199502560 X:148524173-148524195 ACTAGGTTATAGTCTGAAGGGGG - Intronic
1200493955 Y:3858546-3858568 TCAAGGTTATATTCGAAGGGAGG - Intergenic