ID: 1133636125

View in Genome Browser
Species Human (GRCh38)
Location 16:7667487-7667509
Sequence TTCGTTTTTAAAAGAGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 1, 1: 0, 2: 7, 3: 76, 4: 667}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133636121_1133636125 12 Left 1133636121 16:7667452-7667474 CCAGCATGTTCTGATGAGTGGAA 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1133636125 16:7667487-7667509 TTCGTTTTTAAAAGAGATGATGG 0: 1
1: 0
2: 7
3: 76
4: 667
1133636116_1133636125 30 Left 1133636116 16:7667434-7667456 CCTACCTCCCTTGAGATACCAGC 0: 1
1: 1
2: 1
3: 7
4: 149
Right 1133636125 16:7667487-7667509 TTCGTTTTTAAAAGAGATGATGG 0: 1
1: 0
2: 7
3: 76
4: 667
1133636117_1133636125 26 Left 1133636117 16:7667438-7667460 CCTCCCTTGAGATACCAGCATGT 0: 1
1: 0
2: 1
3: 12
4: 91
Right 1133636125 16:7667487-7667509 TTCGTTTTTAAAAGAGATGATGG 0: 1
1: 0
2: 7
3: 76
4: 667
1133636118_1133636125 23 Left 1133636118 16:7667441-7667463 CCCTTGAGATACCAGCATGTTCT 0: 1
1: 0
2: 1
3: 8
4: 126
Right 1133636125 16:7667487-7667509 TTCGTTTTTAAAAGAGATGATGG 0: 1
1: 0
2: 7
3: 76
4: 667
1133636119_1133636125 22 Left 1133636119 16:7667442-7667464 CCTTGAGATACCAGCATGTTCTG 0: 1
1: 0
2: 2
3: 13
4: 170
Right 1133636125 16:7667487-7667509 TTCGTTTTTAAAAGAGATGATGG 0: 1
1: 0
2: 7
3: 76
4: 667

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133636125 Original CRISPR TTCGTTTTTAAAAGAGATGA TGG Intronic
901120933 1:6893105-6893127 TGCATTTTTAGTAGAGATGAGGG - Intronic
901375388 1:8834718-8834740 TTTATTTTTAGTAGAGATGAGGG + Intergenic
902366702 1:15979952-15979974 TTTATTTTTAGTAGAGATGAGGG - Intergenic
902421285 1:16282524-16282546 TTTTTTTTTAAAAGAGAAAATGG - Intronic
902597274 1:17518155-17518177 TTACTTATCAAAAGAGATGATGG + Intergenic
904072394 1:27811507-27811529 TTGTTTTTTAATAGAGATGAGGG + Intronic
904258923 1:29276026-29276048 TTAGTTTTTAAAATAGATATTGG + Intronic
904332772 1:29773748-29773770 ATTATCTTTAAAAGAGATGATGG + Intergenic
904966056 1:34373604-34373626 TTTCTTTTTAAAAGAGAAGAAGG - Intergenic
905169924 1:36103755-36103777 TGCATTTTAAATAGAGATGAGGG + Intronic
905799565 1:40834570-40834592 TTTATTTTTTAAAGAGATGGGGG - Intronic
906842644 1:49156690-49156712 TAAGTTTATAAAAGATATGATGG - Intronic
908081555 1:60584781-60584803 TTGGTTTTTATGAGAGCTGATGG - Intergenic
908343810 1:63210780-63210802 TTTTCTTTTAAAAGAGAGGAGGG + Intergenic
909139503 1:71845934-71845956 TTTTTTTTTTTAAGAGATGAGGG + Intronic
910554944 1:88521218-88521240 TTGGTTTTTTGTAGAGATGAGGG + Intergenic
910617269 1:89212861-89212883 TGCCCTTTTAAAAGAGCTGAAGG + Intergenic
910876434 1:91883176-91883198 TTCACTTTTTAAAGAGATGGGGG + Intronic
911188119 1:94924038-94924060 TTCTTTGTTAAATGAGATGTGGG + Intronic
911241014 1:95466634-95466656 TTCTTTTTTAAAAATCATGAAGG + Intergenic
913297407 1:117335371-117335393 TGTGTTTTTAATAGAGATGGGGG + Intergenic
914438933 1:147685610-147685632 TGCCCTTATAAAAGAGATGAAGG + Intergenic
916103614 1:161413666-161413688 TTTTTTTTTAATAGAGATGAGGG - Intergenic
916213043 1:162373890-162373912 TTTATTTTTAAAAGAGAGAAAGG + Exonic
916389143 1:164311394-164311416 TACGTTTTCAAAAGAGAGGTAGG - Intergenic
916426292 1:164683986-164684008 TTAGATTTTCATAGAGATGAAGG + Intronic
916553184 1:165869673-165869695 TTTTTTTTTTAAAGAGATGGGGG + Intronic
916676413 1:167067401-167067423 TACTTTTTTAAAAAAGAAGAAGG - Intronic
916780637 1:168024208-168024230 TTTTTTTTTTAAAGAGATGGGGG - Intronic
917011960 1:170484615-170484637 TTGTTTTTTAGTAGAGATGAGGG + Intergenic
917544982 1:175955546-175955568 TTCATTTGCAAAAGAGATGATGG + Intronic
917564408 1:176197237-176197259 TAAGTTTTTAATAGAGATGAGGG - Intronic
917816804 1:178719458-178719480 TTGTTTTTTAAAAGAGGTAAGGG - Intergenic
918152193 1:181807118-181807140 TTTTTTTTTTTAAGAGATGAGGG - Intronic
918317877 1:183338137-183338159 TTTTTTTTTTAAAGAGATGGGGG - Intronic
918578083 1:186088468-186088490 TTCTTTTTTAAAAAAGAAAATGG + Intronic
918805579 1:189037218-189037240 TTGATTTTTCAAAGAGATGGTGG - Intergenic
919771158 1:201159584-201159606 TTTTTTTTTTAAAGAGATGAGGG + Intronic
919994347 1:202734284-202734306 TTTTTTTTTAATAGAGATAATGG - Intronic
920526398 1:206669901-206669923 CTGGTTTTTAAATGAGATTAGGG + Intronic
920880283 1:209873779-209873801 TTCCTTTTTCAGGGAGATGAGGG + Intergenic
921267965 1:213441336-213441358 TCAGTTTTTAAAAGAGACTAAGG - Intergenic
922288703 1:224192197-224192219 TTTTTTTTTAAGAGAGAGGAGGG + Intronic
923693373 1:236220015-236220037 TTTTTTTTTAAAAGAGATGAGGG - Intronic
924450288 1:244172620-244172642 TTCGTTGTCAGATGAGATGAGGG + Intergenic
924575030 1:245272393-245272415 TTTGTTTTTTAAAGAGATGAAGG - Intronic
924703697 1:246480303-246480325 TTCATTTTAAAAAGAGAAGTCGG + Intronic
924837989 1:247674046-247674068 TTCTTTTCTAAAAAAGATGGGGG + Intergenic
1063035812 10:2285694-2285716 TTCGTCTTGGAAACAGATGATGG - Intergenic
1063172912 10:3525881-3525903 TTCCTTTTTAAAGGAGAGAAAGG + Intergenic
1063183900 10:3633099-3633121 TTTGTTTTTCAGAGTGATGACGG + Intergenic
1063444773 10:6104797-6104819 TTTGTCTTTAAAACAGAGGAAGG + Intronic
1063635327 10:7776882-7776904 TTTTTTTTTAATAGAGATGGGGG - Intronic
1063674406 10:8127281-8127303 TTTTTTTTTATAAGAGATGGGGG + Intergenic
1063727764 10:8657418-8657440 TTCATTTTTAAATGATATTATGG - Intergenic
1063737925 10:8782306-8782328 TTCCTTTTTAAAAGAAAGGATGG - Intergenic
1063874764 10:10462644-10462666 TTCTTTTTTTAAAGAGCTGAAGG + Intergenic
1064072019 10:12238700-12238722 TTAATTTTTAGTAGAGATGAGGG - Intronic
1064513354 10:16119418-16119440 TTCTTTTTTTAAATAGATGGGGG + Intergenic
1064873670 10:19968484-19968506 TTTGTTTTTAGTAGAGATGGGGG + Intronic
1065343833 10:24729237-24729259 TATTTGTTTAAAAGAGATGAAGG - Intergenic
1067102274 10:43342277-43342299 TTAGTTTTTAAAAGATTTAAAGG - Intergenic
1067391917 10:45871276-45871298 TCCGTTTTGAAATGAAATGAAGG - Intergenic
1067871380 10:49964877-49964899 TCCGTTTTGAAATGAAATGAAGG + Intronic
1068412021 10:56668399-56668421 TTCTTTTTTAAAATAAATAAAGG + Intergenic
1068442235 10:57072515-57072537 TTTTTTTTTTGAAGAGATGAGGG + Intergenic
1068761575 10:60716814-60716836 TTCCTTTTTAACATTGATGAAGG - Intronic
1068947327 10:62742596-62742618 GTCTTTTTTTAAACAGATGAAGG - Intergenic
1068984665 10:63096035-63096057 TTATTTTTTAAGAGAGATGGGGG - Intergenic
1069657073 10:70097935-70097957 CCCTTTTTTATAAGAGATGAGGG - Intronic
1070074582 10:73122752-73122774 TTTTTTTTTAATAGAGATGGGGG + Intronic
1071102257 10:82052576-82052598 TTCATTCTTAAAACAGATCAGGG - Intronic
1071159780 10:82732332-82732354 TTCATTTTTAAAATAAATCATGG + Intronic
1071254745 10:83861704-83861726 TTTATTTTTAGTAGAGATGAGGG - Intergenic
1071451739 10:85799018-85799040 TTGATTTTTATAAGAGATAAGGG + Intronic
1071453789 10:85826155-85826177 TTTTTTTTTAGTAGAGATGAGGG - Intronic
1071694067 10:87853474-87853496 TTTTTTTTTTAAAGAGATGGGGG + Intergenic
1072117661 10:92379339-92379361 GTCATTTTTAAAAGAGATGATGG - Intergenic
1072889600 10:99310918-99310940 TCTGTTTTTAAAATGGATGATGG - Intergenic
1073305180 10:102497654-102497676 TTTTTTTTTTAAAGAGATGGGGG + Intronic
1073413581 10:103362953-103362975 TTCTTTTTTAAAAGAGACATAGG + Intergenic
1073662343 10:105490446-105490468 TTTGGTTTGAAAGGAGATGAAGG + Intergenic
1074358539 10:112806757-112806779 TTAATTTTTCACAGAGATGAGGG + Intronic
1076640761 10:131915475-131915497 TTGGGTTTTTGAAGAGATGAAGG + Intronic
1076947719 10:133663477-133663499 TTTTTTTTTAAAAGAGATCTGGG + Intergenic
1077574084 11:3366510-3366532 TTTGATTTAAAAATAGATGAAGG + Intronic
1077874246 11:6290332-6290354 TTTGTTTTAAAGAGAGAGGAAGG + Intergenic
1078784786 11:14478400-14478422 TATTTTTTTAAGAGAGATGAGGG - Intronic
1079171371 11:18099105-18099127 TTGTTTTTTAAAAGAGATGGGGG + Intronic
1079640309 11:22796800-22796822 TTAGTGTTTAGAAGAGATAATGG + Intronic
1080775940 11:35386888-35386910 TTCATTTTTAAAAAAGAACAAGG + Intronic
1081109233 11:39112576-39112598 TTCGTCTGTTAAAGAAATGAAGG + Intergenic
1081879960 11:46441210-46441232 TTCGTTATTAAAAGATAAGCTGG + Intronic
1082638402 11:55624969-55624991 TTAGTTTTTTGAAGAGCTGATGG + Intergenic
1082849878 11:57755019-57755041 TTCTTTTTTAAAAGAGAGACAGG + Intronic
1083199886 11:61114294-61114316 TTCATTTTTAAAAAAATTGATGG + Intronic
1083237365 11:61360066-61360088 TTTTTTTTTTTAAGAGATGAGGG - Intronic
1084197965 11:67536272-67536294 TTTGTTTTTTAATGAGATGGGGG - Intergenic
1085072352 11:73558772-73558794 TTATTTTTTAAAAAAGAAGAAGG + Intronic
1085290811 11:75398196-75398218 TTCACTTTTCATAGAGATGAGGG + Intergenic
1085817273 11:79752582-79752604 TTCGTTTTTATATGTGGTGAGGG - Intergenic
1086245293 11:84744583-84744605 TTCAATTTTAAAATAGATTAAGG - Intronic
1087102413 11:94378773-94378795 TCTGTTTTCACAAGAGATGAGGG - Exonic
1087512221 11:99111404-99111426 TTCTTTTTTACAAGAAAAGAAGG + Intronic
1087958184 11:104315899-104315921 TGCATTTTTAGTAGAGATGAGGG + Intergenic
1088182491 11:107128117-107128139 TTCTTTTTTTAGAGAGTTGAGGG - Intergenic
1088254730 11:107892486-107892508 TTCTTTTTTAAAAAAAATTAAGG + Intronic
1088258542 11:107923827-107923849 TTCTTTTTTAATAGAGATTGAGG + Intronic
1088619697 11:111669575-111669597 TTCTTTTTTAAAAGAGATGGAGG - Intronic
1088672120 11:112152368-112152390 TTAGTTATTACAAGAAATGATGG - Intronic
1089112660 11:116069083-116069105 GTGCTTTTTCAAAGAGATGAGGG - Intergenic
1090948788 11:131454387-131454409 TTTGTTTTTAAGAGAGAAAAGGG - Intronic
1091530118 12:1346633-1346655 TTTGTTTATTTAAGAGATGATGG + Intronic
1092805520 12:12218820-12218842 TTTGTTTTTTAAAGAGATGGGGG - Intronic
1092807569 12:12239357-12239379 TTCCATTTTTAAAGAGCTGATGG + Intronic
1092921274 12:13233644-13233666 TTCGTTTATGAAATAAATGAAGG + Intergenic
1092960131 12:13588943-13588965 TTCGTTCTTAAAAAATAGGATGG - Intronic
1092997697 12:13965313-13965335 TTCTTTGAAAAAAGAGATGATGG - Intronic
1093232197 12:16559778-16559800 TTCATTTTTTATAGAGATGATGG - Intronic
1096055207 12:48645130-48645152 TTCTTTTTAATAAGAAATGATGG - Intergenic
1096191809 12:49624205-49624227 TTCCTTTTTAAAAAAATTGATGG - Intronic
1096350934 12:50900888-50900910 TTAGTTCTTAAAAGAGCTAAGGG - Intergenic
1097032961 12:56102794-56102816 TTTTTTTTTTAAAGAGATGGGGG - Exonic
1097381583 12:58901861-58901883 TTCGTTCTTAGAAGTGATTAAGG + Intronic
1097751029 12:63353196-63353218 TTAGTTCTTAAAATATATGATGG + Intergenic
1097919823 12:65059823-65059845 TGTGTTTTTAGTAGAGATGAGGG + Intronic
1098348616 12:69532864-69532886 TTAGTTTTTAAAAAGGATGGCGG - Intronic
1098410769 12:70181250-70181272 TCAGTGTTTAAGAGAGATGATGG + Intergenic
1098785855 12:74754151-74754173 TTTTTTGTTAAAAAAGATGATGG - Intergenic
1098875166 12:75859389-75859411 TACTTTTTGAAAACAGATGAAGG - Intergenic
1098930610 12:76408132-76408154 TTTTTTTTTTTAAGAGATGAGGG - Intronic
1099143724 12:79012628-79012650 TTCCTTTCAAAAAGAGCTGAAGG + Intronic
1099630034 12:85131035-85131057 TTTTTTTTTAGTAGAGATGAAGG - Intronic
1100387560 12:94118045-94118067 TTTATTTTTAATAGAGACGAGGG - Intergenic
1101677440 12:106931258-106931280 TTTTTTTTTTAAAGAGATGAGGG - Intergenic
1101707672 12:107235583-107235605 TTTGTTTTTTATAGAGTTGAGGG - Intergenic
1101933400 12:109034552-109034574 TTCTTTTTTAATAGAGATGGGGG - Intronic
1102128565 12:110506056-110506078 TGTGTTTTTAATAGAGATGAGGG + Intronic
1102598104 12:114008283-114008305 TTCTTTTTTGATAGAGATGGGGG + Intergenic
1103102806 12:118194659-118194681 TTCTTTTTTTAAAGAGGGGATGG + Intronic
1103249905 12:119490569-119490591 TTTTTTTTTTAAAGAGATGAGGG + Intronic
1103652261 12:122442087-122442109 TTTATTTTTAGTAGAGATGAGGG + Intergenic
1103732377 12:123036509-123036531 TTCTTTTTTAATAGAGAGGAGGG - Intronic
1103842317 12:123875209-123875231 TTCTTTTTTAAAAAAAATCAAGG + Exonic
1104029294 12:125053025-125053047 TTTTTTTTTAATAGAGATGGGGG - Intergenic
1104036898 12:125104025-125104047 TTCATTTTGAATAGAGATTAAGG + Intronic
1104399602 12:128464578-128464600 TTCATTTTTTATAGAGATGGGGG - Intronic
1104509160 12:129360486-129360508 TGGGTTCTTAAAAGAGACGAGGG + Intronic
1105043285 12:132978790-132978812 TGCATTTTTAACAGAGACGAGGG - Intergenic
1105758548 13:23492290-23492312 TTTTTTTTTAATAGAGATGGGGG - Intergenic
1105841381 13:24256568-24256590 TTTTTTTTTTAAAGAAATGAAGG + Intronic
1107252951 13:38387820-38387842 TGCATTTTTAGTAGAGATGAGGG + Intergenic
1107439111 13:40408570-40408592 TATGTTTTTAAAGGAGATGGGGG - Intergenic
1108610276 13:52078594-52078616 TTTTTTTTTTAAAGAGATGGCGG + Intronic
1108921063 13:55675008-55675030 TTCGCTTTTAAAAGAAATGTAGG - Intergenic
1109361460 13:61299453-61299475 TGTGTTTTTAATAGAGATGGAGG + Intergenic
1109436411 13:62309282-62309304 ATCATGTTTTAAAGAGATGAAGG + Intergenic
1109771813 13:66984542-66984564 TTCATTTTTAAAAGGGTAGAGGG + Intronic
1109774537 13:67022716-67022738 CTTGTTTTTAAAATAGGTGAGGG - Intronic
1109969877 13:69754012-69754034 TTTGTTTTTAGTAGAGATGGGGG + Intronic
1111731978 13:92087940-92087962 TTTTTTTTTTAAAGAGATGGGGG + Intronic
1111816174 13:93156239-93156261 TTATATTTTAAAAGAGAGGAAGG + Intergenic
1111905213 13:94247830-94247852 TTCTTTTTTTAAAGAGATGGGGG + Intronic
1111987120 13:95076931-95076953 TGAGTTTTTCATAGAGATGAGGG + Intronic
1112114945 13:96341650-96341672 TTTGTTTTGAAAAGATATGGAGG + Intronic
1112521365 13:100098194-100098216 TTTGTTTTTTTAAGAGATGGGGG - Intronic
1112756545 13:102641168-102641190 TTCTTTTTTACAAGAGCTGTGGG + Intronic
1112870461 13:103964586-103964608 TAATTTTTTAAAAAAGATGATGG + Intergenic
1113385898 13:109847809-109847831 TTCTTATTTAGAAAAGATGAGGG + Intergenic
1113858412 13:113463517-113463539 TTTTTTTTTTAAAGAGGTGAGGG - Intronic
1114349266 14:21832590-21832612 TTTGTTTTTTGTAGAGATGAGGG - Intergenic
1114592745 14:23882597-23882619 TTAGTTTTTAAAAAACATTAGGG - Intergenic
1115245378 14:31288912-31288934 TTTTTTTTTAATAGAGATGGTGG - Intergenic
1115531266 14:34330014-34330036 TTTTTTTTTAATAGAGATGGGGG - Intronic
1115699376 14:35935476-35935498 TTTGTTTTTTATAGAGACGAGGG + Intergenic
1116004412 14:39277205-39277227 GTTTTTTTTAAAAGAGATGAGGG + Intronic
1116334846 14:43644228-43644250 TATGTTTTTAAAAAAAATGATGG - Intergenic
1117700655 14:58410042-58410064 TTATTTTTTAGTAGAGATGAGGG + Intronic
1117926418 14:60784349-60784371 TTTTTTTTAAATAGAGATGAGGG + Intronic
1117991981 14:61442756-61442778 TTTTTTTTTAATAGAGATGGAGG - Intronic
1118588465 14:67379926-67379948 TTTCTTTTTAATAGAGATGGAGG + Intronic
1118881824 14:69834368-69834390 TTCTTTTTTAAAAAAGAAGCAGG + Intergenic
1119123733 14:72104077-72104099 TTTGTTTTTAAAAATGATGTTGG + Intronic
1119222069 14:72916886-72916908 TTTATTTTTCATAGAGATGAGGG - Intergenic
1119253731 14:73180156-73180178 TGCATTTTTAGTAGAGATGAGGG + Intronic
1119283182 14:73428297-73428319 TTCTTTTTTTAAACAGATAAAGG - Intronic
1119289476 14:73483687-73483709 TTTATTTTTAAAATGGATGATGG + Intronic
1119392054 14:74297562-74297584 TTCTTTTTTTTAAGAGATGGGGG + Intronic
1119572169 14:75684455-75684477 TTTGTTTTTAAAATAATTGAAGG + Intronic
1120281861 14:82449227-82449249 TATGTTTTAAAAAGAGAAGATGG + Intergenic
1120913078 14:89685487-89685509 TTCTTTTATAAAAGGGAGGAGGG + Intergenic
1121346861 14:93142582-93142604 ATTTTTTTTTAAAGAGATGAGGG - Intergenic
1121543533 14:94746502-94746524 TTCGTTCTTCACTGAGATGAGGG - Intergenic
1122236884 14:100335968-100335990 TTTTTTTTTAAAAGAAATGAGGG + Intronic
1122483443 14:102062637-102062659 TTTTTATTTAAAAGAGATGGAGG + Intergenic
1122755501 14:103975953-103975975 TCCTTTTTAAAGAGAGATGAGGG - Intronic
1124123747 15:26915858-26915880 CTCATTTGTAAAATAGATGAGGG + Intronic
1124388652 15:29232469-29232491 TTTTTTTTTTAAAGAGATGGGGG + Intronic
1124406595 15:29398412-29398434 TTCTTTTTTAAAAGAGAGGATGG - Intronic
1125089643 15:35775175-35775197 TTCTTTTTCAAAAAAGATTATGG - Intergenic
1125691093 15:41596808-41596830 TTTTTTTTTAATAAAGATGAGGG + Intergenic
1126397613 15:48235631-48235653 TTTGTTTTTTAAAGAGATCAGGG - Intronic
1126639963 15:50814386-50814408 TTCTTTTTTAAAAGAAATTGTGG + Intergenic
1126813246 15:52429775-52429797 TTAATTTTTAATAGAGATGGGGG + Intronic
1127052675 15:55101126-55101148 TTCTCTTTTAAATGGGATGATGG - Intergenic
1127282633 15:57504920-57504942 TTCCTTTTTAAAACAGATGAGGG + Intronic
1127594686 15:60467951-60467973 TTCCATTTTAAAAAAAATGACGG + Intronic
1127628268 15:60801364-60801386 TTCTTTATTAAAACAAATGAAGG - Intronic
1127721859 15:61709847-61709869 TGCATTTTTAATAGAGATGGGGG + Intergenic
1128200722 15:65804399-65804421 TTCATTTTTAGTAGAGATGGGGG - Intronic
1128295818 15:66518503-66518525 TTTCTTTTAAAAAGATATGAGGG - Intronic
1128921131 15:71611347-71611369 TTCCTTCTAGAAAGAGATGAAGG + Intronic
1129142252 15:73610259-73610281 TTAGTTTTTTGTAGAGATGAGGG + Intronic
1129318343 15:74759809-74759831 TTGTTGTTTTAAAGAGATGAGGG + Intergenic
1129358132 15:75006296-75006318 TTATTTTTTAAAAGAGAGGGAGG - Intronic
1129899597 15:79136344-79136366 TTTGTTTATAAAAGACAGGATGG - Intergenic
1130349785 15:83081046-83081068 ATCATTTATAAAAGAGATAAAGG - Intergenic
1130938004 15:88486408-88486430 TTCTTTTTTTTAAGAGATGGGGG - Intergenic
1131680545 15:94717572-94717594 TTTGTTTTTAAAAGAAAAGCTGG + Intergenic
1132267818 15:100491896-100491918 TTTTTTTTTTTAAGAGATGAGGG + Intronic
1133186057 16:4099435-4099457 TTTCTTTTCAAAAAAGATGAGGG + Intronic
1133636125 16:7667487-7667509 TTCGTTTTTAAAAGAGATGATGG + Intronic
1134411383 16:14005208-14005230 TTTGTTTTTTAAAGTAATGAAGG + Intergenic
1134466140 16:14479412-14479434 TTTTTTTTTAATAGAGATGGGGG - Intronic
1134657898 16:15961016-15961038 TTTTTTTTTAAAATAGATGGGGG + Intronic
1134680653 16:16122698-16122720 TTTTTTTTTAAGAGAGATGGGGG - Intronic
1135283366 16:21172136-21172158 TTTTTTTTTTAAAGAGATGGAGG - Intronic
1135378271 16:21969876-21969898 TTTTTTTTTTAAAGAGATGGAGG + Intronic
1135783311 16:25325466-25325488 TTCTTTATGAAAACAGATGATGG + Intergenic
1135810323 16:25580891-25580913 TTTTTTTTTAAAAAAGATGGGGG - Intergenic
1136319361 16:29472611-29472633 TTTTTTCTTAATAGAGATGAGGG - Intergenic
1136343330 16:29659555-29659577 TTCTTTTTTGGTAGAGATGAGGG + Intergenic
1136382612 16:29902822-29902844 TTCTTTTTTAAAAGGGTTGGTGG + Intronic
1136433932 16:30211955-30211977 TTTTTTCTTAATAGAGATGAGGG - Intergenic
1136542909 16:30938340-30938362 TTCTTTTTTAATAGAGATGGGGG - Intronic
1136562425 16:31048031-31048053 TTTGTTTTTAGTAGAGATGGGGG + Intergenic
1136847237 16:33586435-33586457 TTTCTTTTTTTAAGAGATGAGGG - Intergenic
1137050379 16:35706654-35706676 TTCGTTTTTAAAAATTATGAAGG + Intergenic
1137663677 16:50234256-50234278 TTTGTTTTTTTAAGAGATGAAGG - Intronic
1137761422 16:50943826-50943848 TTGATTTTTAAATCAGATGAAGG - Intergenic
1138056834 16:53843821-53843843 TTTTTTTTTAATAGAGATGGGGG + Intronic
1138077735 16:54058800-54058822 TTTATTTTTTAAAGAGAGGAGGG - Intronic
1138960762 16:62026202-62026224 TTGGGTTTTAACAGAGCTGATGG - Intronic
1139571792 16:67817452-67817474 TGCGTTTTTAGTAGAGACGAGGG + Intronic
1139760113 16:69178116-69178138 TTCCTTATAAGAAGAGATGAGGG - Intronic
1139792613 16:69452103-69452125 TACTTTTTTAAAGGAAATGATGG - Intronic
1140586781 16:76302273-76302295 ATAGTTTTGAAAAGAGCTGAAGG + Intronic
1140678144 16:77354317-77354339 TTCTTTTTTTAAACAGATAATGG + Intronic
1141174747 16:81711362-81711384 TTCCTTTTTTAAAAAAATGAGGG - Exonic
1141203957 16:81918859-81918881 TTCATGTTTCAAACAGATGAAGG + Intronic
1141821095 16:86446472-86446494 TGAGTTGTTAAAAGAGAAGAGGG - Intergenic
1203108945 16_KI270728v1_random:1435090-1435112 TTTCTTTTTTTAAGAGATGAGGG - Intergenic
1142835003 17:2578889-2578911 TTAATTTTTAATAGAGATGGGGG - Intergenic
1142918278 17:3161825-3161847 TTTTTTTTTTAAAGAGATGTAGG - Intergenic
1143065398 17:4243369-4243391 TTTTTTTTTTAAACAGATGAGGG + Intronic
1143343179 17:6230060-6230082 TTTTTTTTTAATAGAGATGGGGG - Intergenic
1143656820 17:8299529-8299551 TTTTTTTTTAGTAGAGATGAGGG - Intergenic
1144228190 17:13172647-13172669 TTTGTTTTTAACAAAAATGAGGG + Intergenic
1144580243 17:16454794-16454816 TTCTTTTTTTAAAGAGATGGGGG + Intronic
1144823584 17:18092437-18092459 CTCTTTTTTTAAAGAGATGGGGG - Intronic
1145213055 17:21029411-21029433 TTCTTTTTTAAAAAATCTGATGG - Intronic
1145281907 17:21474273-21474295 GTTGTTTTCAAAAGAAATGATGG - Intergenic
1146389499 17:32408616-32408638 TTCTTTTTTTCAAGAGATGGGGG - Intergenic
1146986214 17:37221137-37221159 TTATTTTTTAAAAGACAGGAAGG + Intronic
1147361333 17:39932544-39932566 TTTGTTTTTTATAGAGATGGTGG - Intergenic
1147777641 17:42914105-42914127 TTTTTTTTTAATAGAGATGGGGG + Intergenic
1147981535 17:44277627-44277649 TTTTTTTTTAATAGAGATGGGGG - Intergenic
1148830906 17:50430365-50430387 TGGGTTTTTAAAAGAAAAGAAGG + Intronic
1148924349 17:51070061-51070083 TTTTTTTTTTTAAGAGATGAGGG - Intronic
1149026566 17:52034486-52034508 TTATTTCTTAAAAGAGAAGAGGG + Intronic
1149920213 17:60650950-60650972 TTTTATTTTTAAAGAGATGAGGG - Intronic
1149978749 17:61292347-61292369 TTTGATTTGAAAAGAAATGAGGG + Intronic
1150096418 17:62380173-62380195 TGTATTTTTAATAGAGATGAGGG + Intronic
1150111084 17:62500074-62500096 TTTATTTTTTAAAGAGATGAGGG + Intronic
1150230549 17:63547491-63547513 TGTGTTTTTAAAATAGATGGTGG - Intronic
1150267391 17:63840344-63840366 TTTTTTTTTTTAAGAGATGATGG + Intronic
1150525326 17:65916717-65916739 TTTTTTTTTAATAGAGATGGGGG + Intronic
1150616745 17:66778206-66778228 ACCGTTTTTAATAGAGATGATGG - Intronic
1151018726 17:70587589-70587611 TTTTTTTTTAAAAGAAATGGTGG + Intergenic
1151518300 17:74611600-74611622 ATCGTTTTTCAAAGACAGGATGG - Exonic
1151630634 17:75308715-75308737 TTTGATTTTTAAACAGATGAAGG + Intergenic
1151663049 17:75529543-75529565 TTTTGTTTTTAAAGAGATGAAGG - Intronic
1151694930 17:75709779-75709801 TTTTTTTTTAGTAGAGATGAGGG - Intergenic
1151987145 17:77550884-77550906 AACATTTTTAAAAGAGATGGGGG + Intergenic
1152194508 17:78909346-78909368 TTTTTTTTTTAAAGAGATGAGGG - Intronic
1152274286 17:79346093-79346115 TGCATTTTTAGTAGAGATGAGGG + Intronic
1203164238 17_GL000205v2_random:79305-79327 TCCGTTTTCAAAAGGGATTAAGG - Intergenic
1153090223 18:1334594-1334616 TTCTTTTTTTCAAGATATGAAGG + Intergenic
1153268302 18:3293844-3293866 TTCCTCTTTCAAAGAGATGGAGG + Intergenic
1153305501 18:3627111-3627133 TTTTTTTTTAATAGAGATGAGGG + Intronic
1153444209 18:5154057-5154079 TTAATTTTTCATAGAGATGAGGG - Intronic
1154998306 18:21662276-21662298 TGCATTTTTAATAGAGATGGGGG + Intronic
1155393699 18:25364104-25364126 TTCGTTTTTAAAAATGATTTGGG + Intergenic
1156005367 18:32434481-32434503 TACTTTTTTAAAAAAGATGGGGG + Intronic
1156592185 18:38503199-38503221 ATCATTTGTAAAAGAGAGGAGGG + Intergenic
1156794245 18:41022684-41022706 TTCGTTTCTCAAACAGATGGGGG + Intergenic
1156829617 18:41475887-41475909 TTTTTTTTTAAAAAAGATAAAGG + Intergenic
1158004372 18:52655129-52655151 TTTTTTTTTAAGAGAGAAGAGGG + Intronic
1158210196 18:55040456-55040478 CTCTTTTCTAAAAGAGAAGAGGG + Intergenic
1158455584 18:57604378-57604400 TTTTTTTTTTAAAGAGATGGAGG - Intronic
1158484638 18:57855145-57855167 TACTTTTTTAAAAGAGATTCTGG - Intergenic
1158623740 18:59054105-59054127 TTTTTTTTTTAAAGAGATGAGGG + Intergenic
1159636926 18:70816178-70816200 TTTATTTTTAAAAGAAAAGATGG + Intergenic
1160146946 18:76372975-76372997 TACATTTTTAGTAGAGATGAGGG - Intronic
1160351174 18:78180631-78180653 AACATTTTTAAAAGAGGTGATGG + Intergenic
1160427185 18:78786729-78786751 TTCGTTTTTACAGGCCATGAAGG - Intergenic
1160453977 18:78983866-78983888 GTTGTTTTTAAAAGAAATGTTGG - Intronic
1160818731 19:1048179-1048201 TTTTTTTTTTAAAGAGATGGAGG - Intronic
1161081668 19:2313451-2313473 TTTTTTTTTTAAAGAGATGAGGG - Intronic
1161742505 19:6031822-6031844 TTCTTTTTTAAAAAAGAGGTGGG + Intronic
1161875523 19:6905649-6905671 TTCTTTTTTAAAAGAAAGGTTGG - Intronic
1161945018 19:7430207-7430229 TTTTTCTTTAAAAGAAATGAAGG + Intronic
1162083329 19:8233052-8233074 TTATTTTTTTTAAGAGATGAGGG + Intronic
1162306001 19:9874337-9874359 TTTTTTTTTAAGAGAGATGGGGG + Intronic
1163111544 19:15164241-15164263 TTTGTTTTTAAAAAAAAGGATGG + Intronic
1163163845 19:15481784-15481806 TTAATTTTTTATAGAGATGAGGG + Intronic
1163480617 19:17554044-17554066 TGTGTTTTTAGAAGAGATGGGGG + Intergenic
1163639528 19:18453729-18453751 TTCATTTTTTGTAGAGATGAGGG + Intronic
1163657458 19:18555512-18555534 TGTGTTTTTAATAGAGATGGGGG + Intergenic
1164049591 19:21573288-21573310 TTTATTTTTAAAAGAGTAGAGGG + Intergenic
1164049747 19:21574890-21574912 TTTATTCTTAAAAGATATGAAGG - Intergenic
1164188144 19:22890257-22890279 TTCATTCTTAAAAGATATAAAGG - Intergenic
1164289590 19:23855414-23855436 TACGTTTTTAAAAGAATTCAAGG - Intergenic
1164979771 19:32605196-32605218 TTTGTTTTTAGTAGAGATGGGGG - Intronic
1165033320 19:33014310-33014332 TTTCTTTTTTTAAGAGATGAGGG + Intronic
1165224276 19:34343279-34343301 TTAATTTTTAGTAGAGATGAGGG - Intronic
1165455159 19:35906492-35906514 TTAGTTTCTCAAAGGGATGAAGG + Intronic
1165618967 19:37228036-37228058 GGCGTTTTTACAAGAGATGGTGG + Intronic
1165659249 19:37560701-37560723 TTCGTTTTGAACAGTTATGATGG + Intronic
1165957152 19:39508108-39508130 TAGGTTTTTCAAAGAGAAGATGG - Exonic
1166079150 19:40432952-40432974 TTTTTTTTTAATAGAGACGAGGG + Intergenic
1166726020 19:45028193-45028215 TTCTTTTTTGAGAGAGATGGGGG + Intronic
1167279745 19:48559945-48559967 TTTTTTTTAAAGAGAGATGAGGG - Intronic
1168303603 19:55421243-55421265 TTTTTTTTTAATAGAGATGGGGG - Intergenic
1168322856 19:55520714-55520736 TTCTTTTTTAATAAAGATGGGGG - Intergenic
1168415977 19:56168697-56168719 TTTATTTTTAGTAGAGATGAGGG + Intergenic
1168519597 19:57038069-57038091 TGTGTTTTTAAAAGAGGAGAAGG + Intergenic
1168534785 19:57159772-57159794 TTTGTTTTTAGTAGAGATTATGG - Intronic
924959199 2:18704-18726 TTCTTTTTTAAATGGGCTGATGG - Intergenic
926102310 2:10126150-10126172 TTTTTTTTTTAAAGAGATGAGGG - Intronic
926447808 2:12965516-12965538 TTCCTTTTTAATAGAGACCAGGG - Intergenic
926757342 2:16246738-16246760 TTTATTTTTAATAGAGATGGGGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
926809429 2:16743242-16743264 TTCATTTTTAGTAGAGATGTGGG - Intergenic
927280873 2:21305337-21305359 TTCGTCTGGAAAAGAGGTGATGG + Intergenic
927890538 2:26745388-26745410 TTTTTTTTTAATAGAGATGGGGG + Intergenic
927923926 2:26996327-26996349 TTTATTTTTAGTAGAGATGAAGG + Intronic
928531081 2:32191854-32191876 TTCTTTTTTTCAAGAGATGGGGG - Intronic
928796271 2:35024499-35024521 GTCCTTTTTCAAAGAGACGAAGG + Intergenic
929027848 2:37622398-37622420 TTCGTTTTTAAATGAATTGATGG + Intergenic
929182811 2:39061686-39061708 TTCTTTTTAAAAATACATGAAGG - Intronic
929234839 2:39594670-39594692 TTTTTTTTTAATAGAGATGGTGG + Intergenic
929367344 2:41175876-41175898 TTCAGTTTTAAAAAAAATGATGG + Intergenic
929465360 2:42139117-42139139 TTCTTTTTTTAAAGACATTAAGG - Intergenic
930043767 2:47150656-47150678 TTTTTTTTTTAAAGAGTTGAGGG + Intronic
930125471 2:47792861-47792883 TTTTTTTTTTAAAGAGATGACGG + Intronic
930757519 2:54992148-54992170 TTTGTTTGTTTAAGAGATGAGGG - Intronic
931006321 2:57853940-57853962 TTCATTTTAAAAAGATATGAAGG - Intergenic
931062446 2:58546470-58546492 TTGGATTTTAGTAGAGATGATGG + Intergenic
931117495 2:59180499-59180521 GCCGTTTTTAAAAATGATGATGG + Intergenic
931424799 2:62161158-62161180 TTTTTTTTTTCAAGAGATGATGG + Intergenic
932195811 2:69782525-69782547 TTTATTTTTTATAGAGATGAGGG + Intronic
932202656 2:69845446-69845468 TTTCTTTTTTAAAGAGATGGGGG + Intronic
933203860 2:79482553-79482575 TTTTTTTTTAAACCAGATGAGGG + Intronic
933903581 2:86867173-86867195 TTCTTTTTTAATAGAGATGGGGG - Intergenic
933904400 2:86875936-86875958 TTGTTTTTTAATAGAGATGGGGG + Intergenic
934069306 2:88368951-88368973 TTAATTTTTAATAGAGATGAGGG + Intergenic
934077222 2:88438625-88438647 TTTGTTTTTAAAGGAGAGGTAGG - Intergenic
934992541 2:98931660-98931682 TTCGTTTTGAAAAGTGCAGATGG - Intronic
935382982 2:102471890-102471912 TTCTTTCTAAAAAGAAATGAGGG - Intergenic
935776934 2:106481791-106481813 TTCTTTTTTAATAGAGATGGGGG + Intergenic
936367842 2:111876215-111876237 TTGTTTTTTAATAGAGATGGGGG - Intronic
936948907 2:117957397-117957419 ATCATTTTTAAAAGAGCTGTAGG - Intronic
937142280 2:119612461-119612483 TTAGTTTTCAAAAGATCTGATGG - Intronic
937187411 2:120057334-120057356 TTAGATTTTAAAATAGACGATGG - Intronic
937382317 2:121390820-121390842 TTCTTTTTTTCAAGAGATGGGGG + Intronic
937393402 2:121513435-121513457 TTTTTTTTTTAAAGAGAAGAAGG + Intronic
938677495 2:133653474-133653496 TTCTTTTATAAAAGGGGTGATGG - Intergenic
938954988 2:136289007-136289029 TTTATTTTTTATAGAGATGAGGG + Intergenic
939387883 2:141524743-141524765 TTCTTTTTCATAAGAGTTGATGG - Intronic
939518943 2:143204925-143204947 TTTTTTTTTAAGAGAGATTAGGG - Intronic
940419094 2:153457485-153457507 TTTATTTTTAAAAGAGGAGATGG - Intergenic
940709674 2:157146384-157146406 TGCTTTTTAAAAAGAGAAGAAGG + Intergenic
940982103 2:160015167-160015189 TTCATTTTTAAATGAAAGGATGG + Intronic
941087638 2:161136189-161136211 TTCCTTTTTATTACAGATGAGGG - Intergenic
941200525 2:162502987-162503009 TTCCATTTTAAAAGAGAAGCTGG - Intronic
941462679 2:165790046-165790068 TTTGTTTTTTGATGAGATGAAGG + Intronic
941578112 2:167261337-167261359 TTTTTTTTAAAAAAAGATGAGGG - Intergenic
941654226 2:168125970-168125992 TTCATATTTAAAGGAGAAGAGGG - Intronic
941824960 2:169884772-169884794 TTCATTTTTAAAGGGGTTGATGG - Intronic
942239459 2:173946318-173946340 TTTTTTTTTTAAAGAGATGGGGG + Intronic
942344137 2:174983918-174983940 TACATTTTCACAAGAGATGATGG + Intronic
943269706 2:185783408-185783430 TTCATTTTTAAAAAAGATGATGG - Intronic
943619992 2:190138669-190138691 TTCAATTTTAAAAGATGTGATGG - Intronic
944166929 2:196733024-196733046 TTAGTCTTTAAAAGATATGCTGG - Intronic
944388064 2:199186522-199186544 TTAATTTTTAAAAGAGATTGGGG - Intergenic
944569146 2:201025415-201025437 ATATTTTTTCAAAGAGATGAAGG + Intronic
945148887 2:206766937-206766959 TTCATTTTTAAATCAGATGTTGG + Exonic
945258386 2:207821749-207821771 TATATTTTTCAAAGAGATGAGGG + Intergenic
946243246 2:218369656-218369678 TTTCTTTTTTTAAGAGATGAGGG + Intergenic
946279339 2:218655483-218655505 TTGTTTTTTTAAAGAGATGGGGG + Intronic
946345173 2:219103574-219103596 TTTGTTTTTAAAAAAAATGGTGG - Intronic
946351072 2:219153103-219153125 TTTCGTTTTAAAAGAGATGCTGG - Intronic
946488910 2:220128940-220128962 TTCATTTTTGGCAGAGATGATGG + Intergenic
946824794 2:223666335-223666357 ATTGTTTTTATAAGAAATGAAGG + Intergenic
947380224 2:229538347-229538369 TACATTTTTCTAAGAGATGAGGG - Intronic
947427803 2:229999547-229999569 TTAATTTTTAAAAGAGAGGTGGG + Intronic
1168894611 20:1314718-1314740 TTTGTTTTTAACAGAGATGGGGG - Intronic
1169036879 20:2460959-2460981 TTTTTTTTTTAAAGAGATGGCGG - Intergenic
1169106557 20:3001015-3001037 TTCATTTTTTAAAGACATGTCGG - Intronic
1169479072 20:5961201-5961223 TTTGTTTTTTTAAGAGATGGGGG - Intronic
1169666413 20:8041653-8041675 TTTTTTTTTAAATGAGATAAAGG + Intergenic
1170154124 20:13254045-13254067 TTTTTTTTTAGTAGAGATGATGG - Intronic
1170198605 20:13717128-13717150 TTTATTTTTCATAGAGATGAGGG + Intronic
1170331902 20:15221685-15221707 TTCTTTTTTAATATAGAGGATGG + Intronic
1171502822 20:25607095-25607117 TTTTTTTTTTAAAGAGATGGGGG + Intergenic
1171948859 20:31403046-31403068 TTTTTTTTTAATAGAGATGGGGG - Intergenic
1172264126 20:33595885-33595907 TTCATTTGTAAAACAGAGGAAGG - Intronic
1172687144 20:36764610-36764632 TTCGTTTTTAAAACTTAGGATGG - Intronic
1173128271 20:40360842-40360864 TTCATTTTTTAAATGGATGATGG - Intergenic
1173214566 20:41068576-41068598 TTTGTTTTTAATAGAGATGGCGG + Intronic
1173996941 20:47345815-47345837 TTTTTTTTTAATAGAGATGGGGG + Intronic
1174103319 20:48143958-48143980 ACCGTTTTTCAAAGAGATGGAGG + Intergenic
1175076046 20:56374606-56374628 TTTTTTTTTAATAGAGATGGGGG + Intronic
1175508909 20:59508475-59508497 TTCCTTTTAAAAAGATAGGACGG + Intergenic
1176337372 21:5611495-5611517 TCCGTTTTCAAAAGGGATTAAGG + Intergenic
1176471034 21:7106721-7106743 TCCGTTTTCAAAAGGGATTAAGG + Intergenic
1176494595 21:7488499-7488521 TCCGTTTTCAAAAGGGATTAAGG + Intergenic
1176506047 21:7649884-7649906 TCCGTTTTCAAAAGGGATTAAGG - Intergenic
1177778607 21:25598426-25598448 TTTTTTTTTTAAAGAGATGGGGG - Intronic
1178174503 21:30080992-30081014 TTGTGTTTTAATAGAGATGAGGG + Intergenic
1178394494 21:32230144-32230166 TTCTTATTTAAAAGAGAGAAAGG - Intergenic
1178419736 21:32433983-32434005 TTATTTTTTAACAGAGATGGGGG - Intronic
1178706836 21:34882628-34882650 TTTGTTTTAAAAAGATATCACGG + Intronic
1179221484 21:39411853-39411875 ATTGTTTTTAAAAGAAATCAGGG - Intronic
1180597642 22:16989206-16989228 TTCTTGTTCAAAAGAAATGAAGG + Intronic
1181885344 22:26017904-26017926 TTCTCATTTAAAAGAGATGGAGG - Intronic
1181962943 22:26636080-26636102 TACGTGTTAAAAAGGGATGAAGG - Intergenic
1182330630 22:29549337-29549359 TGCCTTTTTAAAAGAGAAGGTGG - Intronic
1183960279 22:41407416-41407438 TTTTTTTTTAATTGAGATGAGGG + Intergenic
1184096102 22:42317413-42317435 TTCGATTTAAACACAGATGACGG + Intronic
1184270337 22:43377596-43377618 TTCCATTTTAAGAAAGATGAGGG + Intergenic
1185407658 22:50663860-50663882 TTCTTTTTTTTAAGAGATGGGGG - Intergenic
950196808 3:11015189-11015211 TCCTTTTTTAAAATAGATGTGGG + Intronic
950755647 3:15169706-15169728 ATAATTTTTAAAAGGGATGAAGG + Intergenic
951032818 3:17901698-17901720 TTCATCTTTAGAAAAGATGAGGG + Intronic
951160490 3:19413786-19413808 TTTGTTTTTAAAACAGAGGAGGG - Intronic
951205717 3:19924056-19924078 TTATTTTTTTAAAGAGATAAGGG - Intronic
951583336 3:24189272-24189294 TTCTTTTTTAAAAGAAAAGGGGG - Intronic
951607042 3:24447039-24447061 TCCATTTTTATAAGAAATGAAGG + Intronic
953764653 3:45728844-45728866 TTTGTTTTTTATAGAGATGGGGG + Intronic
954040080 3:47879280-47879302 TTTGTCTTGAAAAGGGATGAGGG + Intronic
954117900 3:48477390-48477412 TTTGTTTTTAAAAGGGAGGCCGG - Intronic
954250182 3:49361428-49361450 TGCCTTTTTAAAAGTGATGATGG - Intronic
954705116 3:52475962-52475984 TGCATTTTTAATAGAGATGGGGG - Intronic
954999214 3:54911364-54911386 TTTTTTTTTTAAAGAGATGGGGG + Intronic
955098418 3:55823058-55823080 TTCTATTTTAAAAGACATGAAGG + Intronic
955278251 3:57568591-57568613 TTTTTTTTTAATAGAGATGGAGG + Intergenic
955891752 3:63657619-63657641 CTGTTTTTTAAAAGAGATGCAGG + Intronic
956276771 3:67510557-67510579 TGCTTTTTTAAGACAGATGAAGG - Intronic
956662153 3:71609880-71609902 TTATTTTTTAATAGAGATGGGGG - Intergenic
957484969 3:80848620-80848642 TTCGTCTTTAAAAAAGGAGAGGG - Intergenic
957879467 3:86192128-86192150 TTAATTTTTAAAAGAGAAAATGG - Intergenic
958041863 3:88235518-88235540 TTGGTTTTAAGAAGAGAGGAGGG + Intergenic
958490018 3:94760793-94760815 TCCATTTTTAAAAATGATGAAGG - Intergenic
959077687 3:101766944-101766966 ATTGTTTTTTAAAGAGATGGAGG + Exonic
959110020 3:102111698-102111720 TATCTTTTTAAAAGAGATGGGGG + Intronic
959369615 3:105506746-105506768 TTCCATTTTAAAAGAGACAATGG - Intronic
959988927 3:112608945-112608967 TTGTTTTTTAAAAGGGAGGAGGG - Intronic
960389109 3:117055044-117055066 TGTGTTTTTGATAGAGATGAAGG - Intronic
960416692 3:117393627-117393649 TTCTTTTTTTTAATAGATGAGGG + Intergenic
960435518 3:117621828-117621850 TTACTTTTTTAAAGAGATGGGGG - Intergenic
961123069 3:124390495-124390517 TTGGTCTTCAAGAGAGATGATGG + Intronic
961848023 3:129784971-129784993 GTTTTTTTTAAAAGAGATGAGGG - Intronic
961884209 3:130085267-130085289 TTATTTTTTAATAGAGATGGGGG + Intronic
962011629 3:131397132-131397154 TTTGTTTTTAATTGAGATGTGGG + Intergenic
962087968 3:132211638-132211660 TGCATTTTTATTAGAGATGAGGG + Intronic
962882081 3:139587781-139587803 TTCCTGTTTAAAAGAAATGGGGG + Intronic
963210132 3:142680089-142680111 ACTGTTTTTTAAAGAGATGAGGG + Intronic
963602939 3:147393005-147393027 TTTTTTTTTGAAAGAGAAGAAGG - Intronic
964227624 3:154426459-154426481 TTATTCTTTAACAGAGATGAAGG - Intronic
964790239 3:160447330-160447352 CTCGGTTTTAAAAGAGAAGCAGG - Intronic
965598654 3:170433312-170433334 TAAGTTTTTTATAGAGATGAGGG + Exonic
966179658 3:177176638-177176660 TGTGTTTTTAATAGAGATGAGGG - Intronic
967085634 3:186092740-186092762 CTGGGTTTTAAAATAGATGACGG + Intronic
967135445 3:186509122-186509144 TTAGAATTTAACAGAGATGAAGG + Intergenic
967516450 3:190374701-190374723 TTCTTTTTGAAAATAAATGATGG - Intronic
967803907 3:193696352-193696374 TAAGTTTTAAAAAGAGATGGAGG + Exonic
968183891 3:196617918-196617940 TTTGTTTTTAGTAGAGATGGGGG - Intergenic
969107435 4:4818417-4818439 TCAGGTTTTAAAGGAGATGAAGG + Intergenic
970269825 4:14333957-14333979 TTCCTTTTTAAAAGAATTTATGG + Intergenic
970602430 4:17650904-17650926 TTTTTTTTTTAAAGAGATGGGGG + Intronic
970653490 4:18203682-18203704 TTTTTTCTTAAAAGGGATGAAGG - Intergenic
970924332 4:21433427-21433449 TTGTTTTTTAATAGAGATGGGGG - Intronic
970963920 4:21906018-21906040 TTTATTTGGAAAAGAGATGAGGG - Intronic
971423918 4:26498080-26498102 TTCATTTTTTTTAGAGATGAGGG + Intergenic
971482939 4:27130416-27130438 TTCGTTTTTGAAAGAGTCAAGGG - Intergenic
971634640 4:29042041-29042063 TAGGTTTTTAACAGACATGAAGG - Intergenic
972483762 4:39523351-39523373 TTGTTTTTTAAAAGTCATGAGGG - Intronic
972757707 4:42066143-42066165 TTAATTTTAAAAATAGATGAAGG - Intronic
973192558 4:47402112-47402134 TTCCTTTTTAAAAGCGGGGAAGG + Intronic
973323494 4:48833608-48833630 GTTGTTGTTAAAAGAGATTAAGG + Intronic
973701625 4:53543031-53543053 TTGTTTTTAAATAGAGATGAGGG + Intronic
974528018 4:63070601-63070623 ATTGTTTTTAAAAGGGATGGGGG - Intergenic
974675443 4:65081880-65081902 TATGTTTTAAAAAGAGATGTAGG - Intergenic
976178638 4:82378792-82378814 TTTCTTTTTTAAAGAGATGGGGG - Intergenic
976736676 4:88317288-88317310 TTTGTTTTTAAGAGAGTTGGGGG + Intergenic
976758851 4:88526832-88526854 TTTGTTTTTAAAATAAATGTTGG - Intronic
977292373 4:95177876-95177898 TTTTTTTTTTTAAGAGATGATGG + Intronic
977433970 4:96969310-96969332 TTCCTTTTCATTAGAGATGAAGG - Intergenic
977441270 4:97070769-97070791 TTTGTTTTTATAATAGATGTGGG + Intergenic
977606371 4:98988758-98988780 TTTATTTTTTAAAGAGATGAGGG + Intergenic
979542439 4:121900643-121900665 CTCTTTTTTAGAAGAGAGGAAGG - Intronic
979916221 4:126437426-126437448 TTATTTTTTAATAGAGATGGTGG + Intergenic
980918642 4:139059764-139059786 TTAGTTTTTAAAATATATCATGG - Intronic
981543957 4:145875178-145875200 TACGTTGTTAAAACAAATGATGG - Intronic
982246544 4:153357876-153357898 TTCTTTTTTAAAAAAGATGTTGG - Intronic
982642807 4:157984289-157984311 TTGGGTTTTATAATAGATGAAGG - Intergenic
983077974 4:163348682-163348704 TTTTTTTTTAAACGAGAGGAGGG + Intronic
983378667 4:166962439-166962461 TTCTAGTTTAAAACAGATGATGG - Intronic
983440605 4:167778762-167778784 TTGATTTTTAAAAGAGGTGTTGG + Intergenic
983626441 4:169806293-169806315 TTTGTTTTAAAAAGAAATGTTGG + Intergenic
983826255 4:172265211-172265233 TTGGTTATCAACAGAGATGAGGG + Intronic
984980638 4:185277322-185277344 TTCTTTTTTAAAGGAGAAGATGG - Intronic
986056326 5:4140712-4140734 TTAGTTCTCAAAAGAGCTGATGG - Intergenic
986504753 5:8437933-8437955 TTTGTTTTTAAGAGAGATTTTGG + Intergenic
986832387 5:11594524-11594546 TTCCTTTTTAAAGAAAATGAAGG + Intronic
986881509 5:12178149-12178171 TTTTTTTTTTAAGGAGATGAGGG - Intergenic
987110462 5:14681237-14681259 TTTTTTTTTAAAAGAGTTTAGGG + Intronic
987320913 5:16768518-16768540 TTCTTTTTAAAAAGAGAAAATGG + Intronic
987569707 5:19640236-19640258 TTAGTTTTTAAAGGAAATTATGG - Intronic
988205674 5:28130506-28130528 TTCTTTTTTAAAAGACTTTATGG + Intergenic
988281167 5:29148950-29148972 TACATTTTTAAAAAAGAAGAGGG - Intergenic
988444465 5:31270074-31270096 TACATTTTTAAAAAAGATAAAGG + Intronic
988809999 5:34775556-34775578 TTCATTTTAAATAGAGATGAGGG - Intronic
988964474 5:36402564-36402586 TTTGTTTTTTAAAGAAATTAAGG + Intergenic
988972231 5:36480867-36480889 TTTTTTTTTAAAAAAGAGGAGGG + Intergenic
989098041 5:37798995-37799017 TTTGTTTTTAACAGAGAAGATGG + Intergenic
990243437 5:53838358-53838380 TTTTTTTTTAATAGAGATGGAGG - Intergenic
991197508 5:63953594-63953616 TATGTTTTAAAAAGATATGAAGG - Intergenic
991702672 5:69331000-69331022 TTCCTTTTTAAAAAAAATGTAGG + Intronic
992456334 5:76919616-76919638 TTTTTTTTTTAAAGAGATGCAGG + Intronic
992682630 5:79167946-79167968 TTTGTTCTTAAAAGAGATAAAGG + Intronic
992814526 5:80423191-80423213 TTAATTTTTAAAATAGATGTAGG + Intronic
993440595 5:87952485-87952507 TTTTTTTTTTTAAGAGATGAGGG + Intergenic
993446816 5:88023187-88023209 TTTTTTTTTAAAAAAAATGAAGG - Intergenic
993779099 5:92043223-92043245 TTCATTTTTAAATGAGGAGAGGG - Intergenic
994147886 5:96414806-96414828 TTAATTTTTAAAAAAAATGAAGG - Intronic
994370244 5:98959299-98959321 TTCTTTTTTTAGAGAGATGAGGG - Intergenic
994435455 5:99725164-99725186 CTGGTTTATAAAAGAGAAGAGGG - Intergenic
995217806 5:109615126-109615148 TTGGTGTTTAAAAGATAAGAAGG - Intergenic
996020399 5:118584997-118585019 TGCATTTTTAAAACAGATGATGG + Intergenic
996248076 5:121290132-121290154 TTAGTTTTTAAAAAAGAGAATGG - Intergenic
996736847 5:126766067-126766089 TTTTTTTTTAATAGAGATGGGGG + Intergenic
996932754 5:128909748-128909770 TGCATTTTTAAAAGAAATCATGG + Intronic
997081141 5:130739693-130739715 TTTATTTTTAGTAGAGATGAAGG - Intergenic
997548494 5:134731682-134731704 TTTGTTATTAAAGGAGAAGAGGG + Intergenic
997564351 5:134875503-134875525 TTTGTTTTTTTAAGGGATGAGGG + Intronic
997915019 5:137916040-137916062 TTCTTTTTTTTAAGAGATGGAGG + Intronic
998126232 5:139624185-139624207 TTTGTTTTTAAAAGAAATTTGGG - Intronic
999211372 5:149892135-149892157 TTTGTTTTTTAGAGAGATGGGGG - Intronic
999843530 5:155454055-155454077 TTCCTTTGTAAAAGGGAGGAAGG + Intergenic
1000098532 5:157992693-157992715 TTTTTTTTTAATAGAGATGGCGG + Intergenic
1000452914 5:161412523-161412545 TATGTTTTTAAAAGATCTGACGG - Intronic
1000514677 5:162225478-162225500 TTCACTTTTAAAAGAGATGGAGG - Intergenic
1000588933 5:163134907-163134929 ATCTTTTTTAATAGAGATGACGG - Intergenic
1000978400 5:167790114-167790136 TTTTTTTTTTAAAGATATGATGG + Intronic
1002119443 5:176990842-176990864 TTTTTTTTTTAAAGAGATGGGGG + Intronic
1002958051 6:1888141-1888163 TTTTTTTTTTGAAGAGATGAGGG + Intronic
1003119664 6:3309125-3309147 TGCGTTTTTAGTAGAGATGGGGG - Intronic
1003380588 6:5621261-5621283 TTTTTTTTTAATAGAGATGGAGG + Intronic
1003488948 6:6604469-6604491 ATTGTTTTTAAAATAGCTGAAGG + Intronic
1004250189 6:14017272-14017294 CTGCTTTTTAAAAGTGATGAGGG - Intergenic
1004423394 6:15491150-15491172 TTAGTTTTTAAAAAAGTTAAAGG + Intronic
1004922099 6:20385419-20385441 TTTGTTTTTTGTAGAGATGAGGG + Intergenic
1005006377 6:21291210-21291232 TGTATTTTTAATAGAGATGATGG + Intergenic
1005331742 6:24757278-24757300 TTGCTTTATAAAAAAGATGAAGG + Intergenic
1005389339 6:25317572-25317594 TTTTTTTTTAATAGAGATGGGGG + Intronic
1005949580 6:30621641-30621663 TTGGTTATAAAAAGAGATTATGG + Intronic
1006348136 6:33499927-33499949 TTCTTTTTTAAGAGACAGGAAGG + Intergenic
1006813963 6:36838739-36838761 TTCGTTGTTGATAGAGATGAAGG + Intronic
1007497662 6:42271975-42271997 TGCGTTTTTAAAATGGATGACGG + Intronic
1007546970 6:42701701-42701723 TTTTTTTTTAGTAGAGATGAGGG + Intronic
1008398590 6:51037509-51037531 TTCTTTATTACAACAGATGATGG + Intergenic
1008733876 6:54518225-54518247 TTTGTTTTTTAAAAAGATGAGGG + Intergenic
1008923305 6:56865507-56865529 TTTGTTTTTTGAAGAGATGGGGG + Intronic
1009435602 6:63614700-63614722 TTTATTTTTAGTAGAGATGAGGG + Intergenic
1010739632 6:79484728-79484750 TTTTTTTTAAAAAAAGATGAGGG - Intergenic
1010962412 6:82160763-82160785 TTCGTTCTTACGAGATATGATGG - Intergenic
1011757249 6:90512776-90512798 TTGGGTTTTAAAAGACATGGGGG + Intergenic
1012394738 6:98783592-98783614 TTCATATTTAAAAAAGAAGAGGG + Intergenic
1012466599 6:99522605-99522627 TTCTTTTTTAGTAGAGATGGGGG - Intergenic
1012681661 6:102190334-102190356 TTCATTTTTAAAATAAATGAAGG - Intergenic
1013076676 6:106777899-106777921 TTTTTTTTTAATAGAGATGGGGG + Intergenic
1013283090 6:108657131-108657153 TTGTTTTGTAAAAGAGAAGATGG + Intronic
1014553122 6:122812045-122812067 TGTGTTTTTAGTAGAGATGAGGG - Intergenic
1014570991 6:123007296-123007318 ATCATTTTTAAAAGAGAAAAGGG + Intronic
1015315977 6:131816711-131816733 TTAGTTTTTAGAAGAGGTGTTGG + Intronic
1015435339 6:133179926-133179948 TTCTTTTTTAAAATAGCTGAAGG + Intergenic
1015491286 6:133829259-133829281 AGAGTTTTTAAAACAGATGAAGG - Intergenic
1016965223 6:149712521-149712543 TTCTTTTTGAATAGAGATGAGGG + Intronic
1017163523 6:151388540-151388562 TTCTTTTTTAATAGAGATGTGGG + Intronic
1017267815 6:152471219-152471241 TTGAATTTTAAAAGACATGAAGG + Intronic
1017781267 6:157717238-157717260 TTCATTTTTTGTAGAGATGAGGG + Intronic
1019698931 7:2463348-2463370 TTTGTTTTTTTTAGAGATGAGGG - Intergenic
1019846116 7:3503668-3503690 TTTGTTTTTTTAAGATATGAAGG - Intronic
1019968042 7:4516377-4516399 TTGGTTTTTAAAATAGTTGTGGG - Intergenic
1019981610 7:4625576-4625598 TTTTTTTTTTAAAGAGATGGGGG - Intergenic
1020172380 7:5855242-5855264 TGCATTTTTAATAGAGATGGGGG + Intergenic
1020175350 7:5877644-5877666 TGCATTTTTAGTAGAGATGAGGG - Intergenic
1020232195 7:6327913-6327935 TTCGTTTTTTAAAAAAAGGAAGG + Intergenic
1020290074 7:6716305-6716327 TATATTTTTAATAGAGATGAGGG - Intergenic
1020713058 7:11632952-11632974 CTAATTTTTAAAAGAGATAATGG - Intronic
1020927620 7:14352171-14352193 TTAGTTTATAAAAGAAAAGATGG + Intronic
1020936001 7:14464792-14464814 CTCATTTTTAAAATATATGAAGG + Intronic
1021729010 7:23578193-23578215 TGTGTTTTTAATAGAGATGGGGG - Intergenic
1022465658 7:30651881-30651903 GGTGTTTTTAAAATAGATGAGGG + Intergenic
1022916712 7:34963019-34963041 TGTATTTTTAATAGAGATGAGGG - Intronic
1023382167 7:39619885-39619907 TTTTTTTTTAATAGAGATGAGGG + Intergenic
1023469789 7:40504230-40504252 TTGTTTTTTAAAAAAGAAGAAGG - Intronic
1024603141 7:51003541-51003563 TTCATATTTAAATGAGATGTTGG - Intergenic
1025107448 7:56183982-56184004 TTCATTTTTTGTAGAGATGATGG - Intergenic
1026620207 7:71943612-71943634 TTTATTTTTAATAGAGATGGGGG + Intronic
1026725092 7:72864653-72864675 TATATTTTTAATAGAGATGAGGG - Intergenic
1026951512 7:74350378-74350400 TTTATTTTTTATAGAGATGAGGG + Intronic
1026955682 7:74375241-74375263 TTTTTTTTTAAAAGAGACGGGGG - Intronic
1027943082 7:84710021-84710043 TTTATTTTTAATAGAAATGAGGG - Intergenic
1028223059 7:88219569-88219591 TTTGTTTTTTAAAGGGAGGAAGG + Intronic
1029294702 7:99530753-99530775 TTCCTTTATAAAAGAACTGATGG + Intronic
1029314584 7:99699875-99699897 TTGATCTTTAAAACAGATGAGGG + Intronic
1029572154 7:101377178-101377200 TTCCTTTTAAATAGAGATGGGGG + Intronic
1029672974 7:102046752-102046774 TTTTTTTTTTGAAGAGATGAGGG + Intronic
1029677133 7:102077516-102077538 TTTTTTTTTTAAAGAGATGGGGG - Intronic
1029718738 7:102349002-102349024 TACATTTTTAATAGAGACGAGGG - Intergenic
1029753877 7:102560253-102560275 TACATTTTTAATAGAGACGAGGG + Intronic
1029771827 7:102659343-102659365 TACATTTTTAATAGAGACGAGGG + Intronic
1030011508 7:105173119-105173141 TTTTTTTTTTAAAGAGATGCGGG + Intronic
1030734600 7:113031856-113031878 TTTTTTTTTTAAAGAGATGAAGG - Intergenic
1031161865 7:118178439-118178461 TACCTTTTTAAAAAAGTTGAAGG - Intergenic
1032008933 7:128328954-128328976 TTTTTTTTTTAAAGAGATGGAGG + Intronic
1032040282 7:128553983-128554005 TTTATTTTTTAAAGAGATGAGGG + Intergenic
1032135142 7:129269606-129269628 TTGTTTTTTAATAGAGATGGGGG + Intronic
1032349673 7:131148870-131148892 TTGGTTTTTAAAACGAATGAAGG + Intronic
1032745333 7:134780650-134780672 TTCCTTTTAGAAAGAGCTGATGG + Intronic
1032776001 7:135113763-135113785 TTCAATTTTAAAAGAGAAAAAGG - Intronic
1033110649 7:138571739-138571761 TTTATTTTTAATAGAGATGGGGG + Intronic
1033114235 7:138611202-138611224 TTTATTTTTAATAGAGACGAGGG - Intronic
1033198514 7:139348208-139348230 TTTTTTTTTAATAGAGATGGGGG + Intronic
1033386102 7:140877276-140877298 TTAGTTTTTTTAAGAGATGGGGG + Intronic
1033938020 7:146612840-146612862 GTAGTTTTTAAATGAGCTGATGG - Intronic
1034071105 7:148186589-148186611 TCCATCTTTAATAGAGATGATGG - Intronic
1034537883 7:151737331-151737353 TTTTTTTTTAATAGAGATGGGGG - Intronic
1034647278 7:152659343-152659365 TTCATTTTTAGTAGAGATGGGGG + Intronic
1035162940 7:156964568-156964590 TTTCTTTTTAAATGAGATGGGGG - Intronic
1035903348 8:3481225-3481247 TTCTTCTTGAAAAGAAATGAAGG + Intronic
1036473160 8:9068989-9069011 TTTATTTTTTATAGAGATGAGGG + Intronic
1037156901 8:15712540-15712562 ATCCTTTTTAAAAGGGGTGATGG - Intronic
1037717636 8:21413228-21413250 TTTTTTTTTTTAAGAGATGAGGG - Intergenic
1037799896 8:22026851-22026873 TTCTTTTTTAAAAAACAAGAAGG - Intronic
1038115544 8:24550894-24550916 TTCTATTTTAAAAGATATGGTGG + Intergenic
1038258931 8:25976605-25976627 TTTGTATTCTAAAGAGATGAGGG + Intronic
1038927482 8:32156709-32156731 TTCTTTTTTAAAAGTGTTCAAGG + Intronic
1038938869 8:32281809-32281831 ATATTTTTTAAAAGAGATGGGGG - Intronic
1039512108 8:38100448-38100470 TTTGTTTTTTGTAGAGATGAGGG + Intergenic
1039664769 8:39513004-39513026 TTTATTTTTAGTAGAGATGAGGG - Intergenic
1039758269 8:40546196-40546218 TTTCTTTTTAAAAAAGAGGAAGG + Intronic
1039993373 8:42509000-42509022 TCCCATTTTAAAAGTGATGAAGG - Intronic
1040455083 8:47589344-47589366 TGCATTTTTAATAGAGATGGGGG - Intronic
1040682168 8:49825249-49825271 ATCCTATTTAAAATAGATGAAGG - Intergenic
1041328793 8:56699700-56699722 TTCTTTTGTAAAACAGAAGATGG - Intergenic
1041912066 8:63099507-63099529 TTTGTTTTTAACAAAAATGAGGG + Intergenic
1042310277 8:67372328-67372350 TCCGTTTACAAATGAGATGAAGG - Intergenic
1042507543 8:69576971-69576993 TTCACTTTTAAAAGAGATGCAGG - Intronic
1042628691 8:70791299-70791321 TTTTTTTTTAAGTGAGATGAGGG - Intergenic
1042827785 8:72995788-72995810 TTACTTTTTAAAAAAGATGTTGG - Intergenic
1043544361 8:81298515-81298537 TTTGCTTTTAAAAGAAATGCTGG - Intergenic
1043830301 8:84980397-84980419 TTCTTTGGTAGAAGAGATGATGG + Intergenic
1044387305 8:91604029-91604051 TTTGTTTTTAGAAGATATGAGGG - Intergenic
1044983394 8:97737527-97737549 TTTGTATTTAAAAGAAATTACGG + Intergenic
1045408179 8:101888588-101888610 TTTTTTTTTAATAGAGATGAGGG + Intronic
1045431049 8:102115322-102115344 TTTGACTTTAAAAGAGAGGAAGG - Intronic
1046270592 8:111891322-111891344 TTTTTTTTTAATAGAGATGAAGG + Intergenic
1046561878 8:115848093-115848115 TTCTTTTTTTAAATAGATGTGGG + Intergenic
1046659382 8:116932674-116932696 TTATTTTTTTAAAGAGATGGGGG + Intergenic
1046725381 8:117668019-117668041 TTTATTTTTAGTAGAGATGAGGG - Intergenic
1046906280 8:119576529-119576551 TTCCTTTTTCACAAAGATGATGG + Intronic
1047479538 8:125268054-125268076 TTTTTTTTAAATAGAGATGAGGG - Intronic
1047972050 8:130093192-130093214 TTCGTTTTTAAAAGCTGTTAAGG + Intronic
1048006042 8:130419961-130419983 TTTTTTTTTAATAGAGATGGGGG + Intronic
1049020951 8:139957383-139957405 TTTCTTTTTAAAATAAATGAAGG + Intronic
1049962307 9:748416-748438 TTTGTTTTTTAAAGAGATGGGGG - Intergenic
1050155536 9:2663022-2663044 ATCATTTTTAAAAAATATGATGG + Intergenic
1050210817 9:3254032-3254054 TTCGTTTCAAAAAGACTTGAAGG - Intronic
1050220257 9:3380097-3380119 TTTGTATTTAGTAGAGATGAGGG + Intronic
1050454900 9:5824699-5824721 TTCTTTTTAAAAAGAGAAGGGGG - Intronic
1050765496 9:9128051-9128073 TACTTTTTTAAAAAAGATGTGGG + Intronic
1051073112 9:13197308-13197330 TTTGTTTTTAAATTAGATGGGGG + Intronic
1052040425 9:23732419-23732441 TTCCTTTTTAAAAAAGAGAAAGG + Intronic
1052808327 9:33033521-33033543 TTTTTTTTTAATAGAGATGGGGG - Intronic
1054759419 9:68991355-68991377 TTGGGTTTTAAAAGAAATGATGG + Intronic
1055248831 9:74278131-74278153 TGTCCTTTTAAAAGAGATGATGG - Intergenic
1055457516 9:76486901-76486923 TTTGTTTTAAGTAGAGATGAGGG - Intronic
1055992810 9:82125825-82125847 TTCTTTATTAAAAGAGATAAGGG - Intergenic
1056202096 9:84286745-84286767 TCCATTTTTAAATGAGGTGATGG - Intronic
1056405342 9:86268707-86268729 TTCTTTTTTTTAAGAGATGGAGG + Intronic
1056596706 9:88013670-88013692 TTCTTTTTTAGTAGAGATGGTGG - Intergenic
1057530431 9:95840590-95840612 TTTTTTTTTTAAAGAGATGGAGG + Intergenic
1058115886 9:101083697-101083719 TTCTTCTTTAAAATAGATAAAGG - Intronic
1058201947 9:102054805-102054827 TTCGTATTAAAAAGAGTTGTGGG + Intergenic
1058365964 9:104208713-104208735 TGCATTTTTAATAGAGATGGGGG + Intergenic
1058377698 9:104342961-104342983 TTTTTTTTTTAAAGAGATGGTGG + Intergenic
1059083340 9:111273652-111273674 TTAGTTTTTTGTAGAGATGATGG + Intergenic
1059787870 9:117606178-117606200 TCCATTTTTGACAGAGATGAGGG + Intergenic
1059819207 9:117953148-117953170 TGGGTTTTTAAGAGAGAAGAGGG + Intergenic
1060293719 9:122328858-122328880 TTTTTTTTAATAAGAGATGAGGG + Intergenic
1060426150 9:123507674-123507696 TTTTTTTTTTTAAGAGATGAGGG - Intronic
1060713914 9:125902082-125902104 TTTTTTTTTAAGAGAAATGATGG + Intronic
1060948802 9:127587440-127587462 TTAATTTTTAATAGAGATGGGGG + Intergenic
1061282174 9:129603727-129603749 TTTATTTTTTAAAGAGATGGGGG + Intergenic
1203424288 Un_GL000195v1:23413-23435 TCCGTTTTCAAAAGGGATTAAGG - Intergenic
1186630731 X:11345970-11345992 TTTTTTTTTTTAAGAGATGAGGG + Intronic
1187452832 X:19413742-19413764 TACTTTGTTAAAAGAGAGGAGGG + Intronic
1187776667 X:22767651-22767673 CTCATTTGTAAAACAGATGAAGG - Intergenic
1188569899 X:31571972-31571994 TTTTCTTTTAAAAGAGATGCCGG + Intronic
1189512110 X:41673289-41673311 TTATGTTTAAAAAGAGATGAGGG + Intronic
1189657046 X:43255393-43255415 TTTGTGTTTAAACAAGATGAGGG - Intergenic
1189693891 X:43644007-43644029 TTTTTTTTTAAAAGAGATAAGGG - Intergenic
1190021566 X:46882923-46882945 TGAATTTTTAATAGAGATGATGG + Intergenic
1190384976 X:49876659-49876681 TACATTTTTAAAACAGATGATGG + Intergenic
1190820712 X:53969059-53969081 TGCATTTTTAGTAGAGATGAGGG - Intronic
1190886369 X:54534051-54534073 TTTTTTTTCAATAGAGATGAGGG + Intronic
1191937274 X:66439256-66439278 TTTGTTTTTAATAGAGATGGAGG + Intergenic
1192206033 X:69096967-69096989 TTTGTTTTTTTAGGAGATGAGGG - Intergenic
1192264233 X:69528008-69528030 TTGGTTTTCACAAGAGGTGAGGG + Intronic
1193467444 X:81866761-81866783 TTAGTTTTTATGAGAGCTGATGG - Intergenic
1195222446 X:102758628-102758650 GTCATTTTTAAAAGAGAGTATGG - Intergenic
1195416030 X:104620337-104620359 TTTTTTTTTTAAAGAGATGGTGG + Intronic
1195450995 X:105012849-105012871 TTCCTTTTTATAAAAGATGTGGG - Intronic
1195914043 X:109918093-109918115 TGCATTTTTAAAAGACAGGAAGG - Intergenic
1196386083 X:115153000-115153022 TTCGTTTTTGAAAGATATTTTGG - Intronic
1196576201 X:117322089-117322111 TGCGTTTTCACAAGATATGATGG + Intergenic
1196668614 X:118343037-118343059 TACATCTTTAAAAGTGATGATGG + Intergenic
1196805717 X:119583944-119583966 TTGCTTTTTAAAAGAGGTGTGGG + Exonic
1196833857 X:119797280-119797302 TGTGTTTTTAATAGAGATGGGGG + Intergenic
1196974846 X:121148074-121148096 GTGGCTTTTAAAGGAGATGAAGG + Intergenic
1197593085 X:128432936-128432958 TTCGTATTTATAAGAGCTGAAGG - Intergenic
1197760396 X:130024125-130024147 TTCGTTGTTAGCAGAGTTGAAGG + Intronic
1198122430 X:133607438-133607460 TTTCTTTTTAATAGAGATGGGGG + Intronic
1198637203 X:138712787-138712809 TTAGTTCTGAAAAGAGGTGATGG - Intronic
1199109862 X:143918578-143918600 TTTGGGTTTGAAAGAGATGATGG + Intergenic
1201330323 Y:12812238-12812260 ATCCTTTTTAAAAGAGAAGTGGG - Intronic