ID: 1133639357

View in Genome Browser
Species Human (GRCh38)
Location 16:7701916-7701938
Sequence GCACCCTGGTTTGCTGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133639357_1133639368 29 Left 1133639357 16:7701916-7701938 CCTGTTGCAGCAAACCAGGGTGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1133639368 16:7701968-7701990 ATCTTTCTGTAGGGCAGAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 264
1133639357_1133639367 26 Left 1133639357 16:7701916-7701938 CCTGTTGCAGCAAACCAGGGTGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1133639367 16:7701965-7701987 CAAATCTTTCTGTAGGGCAGAGG 0: 1
1: 0
2: 1
3: 24
4: 199
1133639357_1133639365 20 Left 1133639357 16:7701916-7701938 CCTGTTGCAGCAAACCAGGGTGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1133639365 16:7701959-7701981 CCCTCTCAAATCTTTCTGTAGGG 0: 1
1: 0
2: 1
3: 7
4: 209
1133639357_1133639363 19 Left 1133639357 16:7701916-7701938 CCTGTTGCAGCAAACCAGGGTGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1133639363 16:7701958-7701980 ACCCTCTCAAATCTTTCTGTAGG 0: 1
1: 0
2: 3
3: 9
4: 185
1133639357_1133639369 30 Left 1133639357 16:7701916-7701938 CCTGTTGCAGCAAACCAGGGTGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1133639369 16:7701969-7701991 TCTTTCTGTAGGGCAGAGGTGGG 0: 1
1: 0
2: 2
3: 34
4: 332
1133639357_1133639361 -6 Left 1133639357 16:7701916-7701938 CCTGTTGCAGCAAACCAGGGTGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1133639361 16:7701933-7701955 GGGTGCATGGCCTGAGGTTCTGG 0: 1
1: 0
2: 1
3: 31
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133639357 Original CRISPR GCACCCTGGTTTGCTGCAAC AGG (reversed) Intronic
900423613 1:2566441-2566463 TGACCCTGGTTTGCTGCACAAGG - Intergenic
901600763 1:10421801-10421823 GCACCCAGCCTTGCTGCCACTGG - Intergenic
904372809 1:30060951-30060973 ACACCCTGGGTAGCTGCAGCTGG - Intergenic
908860576 1:68482548-68482570 GCACCTTGGTTTGCTGTTAGAGG + Exonic
911443739 1:97964229-97964251 GTTTCTTGGTTTGCTGCAACTGG + Intergenic
913066727 1:115262706-115262728 GCACCCTGTTTTCCAGCCACAGG + Intergenic
913700054 1:121365652-121365674 GGTCCCTGGTTTGCTGCTAACGG - Intronic
914040603 1:144046105-144046127 GGTCCCTGGTTTGCTGCTAACGG - Intergenic
914137484 1:144914374-144914396 GGTCCCTGGTTTGCTGCTAACGG + Intronic
921688611 1:218121073-218121095 GCACCCTGCTTTGGGGGAACTGG - Intergenic
921800636 1:219399067-219399089 GCACCCTTGTTGGCTGCAGCAGG + Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1064933656 10:20655553-20655575 TCACCTTGGGTTGCTGCAAAAGG + Intergenic
1064946987 10:20801550-20801572 GCACAATGGTTTTATGCAACTGG + Intronic
1067577929 10:47419629-47419651 GGACCCTGGTTTGGAGCAGCAGG - Intergenic
1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG + Intronic
1073567971 10:104551806-104551828 GCACCATGTTTCGCTGCACCTGG + Intergenic
1075083554 10:119399357-119399379 GCACCTTGCTTCGCTGCATCTGG - Intronic
1075427463 10:122352972-122352994 GCACCCTTATCTGCTGCATCAGG + Intergenic
1075510555 10:123069230-123069252 GCACCATGGTGAGCTGTAACTGG - Intergenic
1078402161 11:11038016-11038038 GCAACTTGGTTTGGTGCAAATGG - Intergenic
1079960053 11:26912949-26912971 GTACACTGGTGTGCTGTAACTGG - Intergenic
1082254751 11:50021311-50021333 TCTCCCAGGTTTGCTGCAGCAGG - Intergenic
1082796446 11:57381349-57381371 ACACCCTGGTTTGCTTCAGAAGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085509655 11:77081837-77081859 GCACTCAGGTCTGCTGCAGCAGG - Intronic
1087212964 11:95461813-95461835 GGACCCTGGTTTACTACACCAGG - Intergenic
1091397655 12:163513-163535 GCCGCCTGGTGTGCTGCAGCCGG + Exonic
1092282000 12:7104652-7104674 GCATCCTGAACTGCTGCAACAGG + Intronic
1098241773 12:68474592-68474614 GGATCCTGCTTTGCTGCATCCGG + Intergenic
1101466099 12:104950768-104950790 GCACCCTGGTTTCCACCCACTGG + Intronic
1102446613 12:113007926-113007948 GGCACCTGGTTTTCTGCAACTGG - Exonic
1102694654 12:114789150-114789172 CCACCCTGGTGTGCATCAACAGG - Intergenic
1103906850 12:124332220-124332242 GCACCGTGGGTTTCTGCCACTGG + Intronic
1104081626 12:125434847-125434869 GCACACTGGTCTGATGCAGCGGG + Intronic
1106371660 13:29140520-29140542 GCAACTTGGTTTCCTACAACAGG - Intronic
1112483554 13:99799808-99799830 ACACCCTGGTTTTCTGGTACAGG + Intronic
1116334423 14:43639304-43639326 GCACCCTGGGTTCTTGCAAAGGG - Intergenic
1121333159 14:93060558-93060580 GGACCCTGCTCTGCTGCAAAAGG + Intronic
1124684246 15:31766923-31766945 GCACCTTGGTTTGCTGTTAGAGG + Intronic
1125927696 15:43576742-43576764 GCACCCTGAAATGCTCCAACTGG + Intronic
1125940839 15:43676307-43676329 GCACCCTGAAATGCTCCAACTGG + Intergenic
1128703625 15:69822216-69822238 GCACCCCGCTCTGCTGCCACAGG - Intergenic
1132236402 15:100225118-100225140 GCTGCATGTTTTGCTGCAACTGG - Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1136508691 16:30722730-30722752 TCACCCTGGTTAGCAGCAAGCGG - Exonic
1139351266 16:66337531-66337553 GCTCCCTGGTCTCCTCCAACCGG - Intergenic
1142219806 16:88848597-88848619 GCATCCTGGTTTTCTGCAGATGG + Intronic
1152415153 17:80155119-80155141 GGTCCCTGGCTTCCTGCAACAGG - Intergenic
1152520110 17:80850816-80850838 GCACCCTGGCCTGCAGCACCTGG + Intronic
1156364469 18:36413087-36413109 GCACCCTGGTTTTCAGCAAAAGG + Intronic
1158404807 18:57151619-57151641 GCACCCTGGTTTCCTGCATGGGG - Intergenic
1161326667 19:3667561-3667583 TCACCCTGGTTGGCAGCCACTGG + Intronic
1162393953 19:10405288-10405310 GAACCCTGTTTTGCTGAAGCTGG - Intronic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1163847176 19:19644142-19644164 GCTCCCTGGTGTGCTGTAATTGG - Intergenic
1164783934 19:30914446-30914468 GCACCCTGGCAGGCTTCAACTGG - Intergenic
1167490276 19:49788988-49789010 GAACCCTCGTGTGCTGCAGCTGG - Intronic
927695173 2:25235006-25235028 ACACCCTGATTTGATGCAAATGG - Intronic
928117572 2:28557949-28557971 CCACCCAGGTTTGCTTCATCTGG + Intronic
939178605 2:138780190-138780212 GGTCCCTGGCTTGCTGCAGCTGG - Exonic
943099084 2:183466120-183466142 GCACCCTTGTTTACTGCATAAGG - Intergenic
948638847 2:239360442-239360464 GCACCCTGCCTTCCTGCAGCAGG + Intronic
1169986200 20:11447611-11447633 GCACCCTGCTAAGCTGCACCTGG + Intergenic
1179490381 21:41737281-41737303 GCACCTTGGTTTGCTCCAGCCGG + Intergenic
1184526300 22:45025471-45025493 ACACCCAGGTTTGCTGCTTCTGG - Intergenic
1184841982 22:47057388-47057410 CCACCCTGGTTCCCTGCACCTGG - Intronic
1185345387 22:50308400-50308422 GCACCTTGGGATGCTGCACCCGG + Intergenic
950839527 3:15953794-15953816 GTACCCTGTTTTTCTGCAATAGG + Intergenic
951077583 3:18415022-18415044 GCTCCCTGGTTTAAAGCAACTGG - Intronic
955621897 3:60873442-60873464 GCAGCCTTGTTTCCTTCAACAGG + Intronic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
972736006 4:41842189-41842211 GCTCCCTTTTTTGCTGCATCAGG + Intergenic
977338000 4:95721992-95722014 CCACCCTGGTTAGCTGAAAGGGG + Intergenic
980994616 4:139768720-139768742 GCACCATGGGGTGCTGCAGCAGG - Intronic
996859745 5:128051432-128051454 GCACTCTAGTTTGATTCAACTGG - Intergenic
1001399707 5:171439241-171439263 GCACCTTGGTATTCTGCAAGAGG + Intronic
1004502905 6:16225012-16225034 GCACCCTGGTTTGGTTTAAGAGG + Intergenic
1007123131 6:39400151-39400173 GCACCCTGTTTGGCTGTCACAGG + Intronic
1007171371 6:39865651-39865673 GCCCCGTGGTGTGCTGGAACTGG + Intronic
1007760991 6:44133688-44133710 GCTGCCTGGTTGCCTGCAACTGG - Intronic
1010455940 6:76054789-76054811 GTCCACTGGTTTGCTGGAACTGG - Intronic
1018363502 6:163096239-163096261 GCACCCTGGGGTGCTGCTATGGG - Intronic
1018478295 6:164165299-164165321 ACACTCTGGTTTGCTACAGCAGG + Intergenic
1019300800 7:302534-302556 CCACACTGGTTTGCTTCAACAGG + Intergenic
1020445177 7:8261446-8261468 GCGCCAGGGTTTGCTGGAACCGG + Intronic
1020580110 7:9987226-9987248 GCACCATGTTGTGATGCAACAGG + Intergenic
1020747424 7:12094773-12094795 GCCCCTGGGTTTGCTGCATCCGG - Intergenic
1021464623 7:20928208-20928230 GCAGCTTTGTTTGCTGCCACTGG - Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1026648380 7:72192939-72192961 GCACTCTGGGATGCTGAAACAGG + Intronic
1036020739 8:4842591-4842613 GCACCCGGGTTCCCTGCAGCAGG - Intronic
1038868369 8:31464758-31464780 GCACCGTGGTAAACTGCAACAGG - Intergenic
1045795282 8:106036716-106036738 GCACCGTGGTTTCCTGCCTCAGG - Intergenic
1050406559 9:5314620-5314642 GTACCCTGCTTTCCTGGAACTGG + Intergenic
1052050507 9:23842422-23842444 GGAGGCTGGTTTTCTGCAACAGG - Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1056164964 9:83932222-83932244 GCCTCCTGGTGTGTTGCAACAGG - Intergenic
1062600040 9:137315483-137315505 GCCCCCAAGTCTGCTGCAACAGG - Intronic
1062677092 9:137753009-137753031 GCACCCTGGTCTGCGGGAATTGG + Intronic
1185699731 X:2221820-2221842 ACACCCTGGTTTTCTGCAGTGGG + Intronic
1188493134 X:30756594-30756616 GCACACTTGTTAGCTGCAGCAGG - Intergenic
1189148768 X:38683526-38683548 GCACCATGGTATGATGCCACTGG - Intronic
1191729024 X:64314292-64314314 GCATGCTTGTTTGCTGCAGCAGG + Intronic
1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG + Intergenic
1197014212 X:121604551-121604573 GCACACTCGTTTGCACCAACAGG + Intergenic
1201525732 Y:14931952-14931974 TAACCCTGGTTTTCAGCAACAGG + Intergenic
1201860307 Y:18590558-18590580 CCATCATGGTTTGCTGAAACAGG - Intergenic
1201873016 Y:18729823-18729845 CCATCATGGTTTGCTGAAACAGG + Intergenic