ID: 1133639363

View in Genome Browser
Species Human (GRCh38)
Location 16:7701958-7701980
Sequence ACCCTCTCAAATCTTTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133639360_1133639363 5 Left 1133639360 16:7701930-7701952 CCAGGGTGCATGGCCTGAGGTTC 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1133639363 16:7701958-7701980 ACCCTCTCAAATCTTTCTGTAGG 0: 1
1: 0
2: 3
3: 9
4: 185
1133639362_1133639363 -8 Left 1133639362 16:7701943-7701965 CCTGAGGTTCTGGAAACCCTCTC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1133639363 16:7701958-7701980 ACCCTCTCAAATCTTTCTGTAGG 0: 1
1: 0
2: 3
3: 9
4: 185
1133639357_1133639363 19 Left 1133639357 16:7701916-7701938 CCTGTTGCAGCAAACCAGGGTGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1133639363 16:7701958-7701980 ACCCTCTCAAATCTTTCTGTAGG 0: 1
1: 0
2: 3
3: 9
4: 185
1133639356_1133639363 20 Left 1133639356 16:7701915-7701937 CCCTGTTGCAGCAAACCAGGGTG 0: 1
1: 0
2: 1
3: 17
4: 126
Right 1133639363 16:7701958-7701980 ACCCTCTCAAATCTTTCTGTAGG 0: 1
1: 0
2: 3
3: 9
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133639363 Original CRISPR ACCCTCTCAAATCTTTCTGT AGG Intronic
903345112 1:22679588-22679610 ACCCTCTCCCATCTCTCAGTGGG + Intergenic
904908163 1:33913544-33913566 ACCCTCTCAAAGTGTTTTGTAGG + Intronic
906153141 1:43599435-43599457 ACTCTCTCTACCCTTTCTGTGGG - Intronic
907938516 1:59064739-59064761 TTCCTCTTTAATCTTTCTGTGGG - Intergenic
907954123 1:59212433-59212455 ACCCTCTCACTTCTTTTTCTGGG - Intergenic
908559237 1:65288499-65288521 ACACTCACAAATCATTATGTAGG - Intronic
909186159 1:72488971-72488993 ACCCTCTCCAACATTTTTGTAGG - Intergenic
909550892 1:76897484-76897506 ACCCTTTCAAAGCATGCTGTGGG + Intronic
910726645 1:90347003-90347025 ACCCTCTCAAATCTTAAGATTGG + Intergenic
913696764 1:121333926-121333948 GGTCTCTCAAAACTTTCTGTGGG + Intronic
914140796 1:144946134-144946156 GGTCTCTCAAAACTTTCTGTGGG - Intronic
920484095 1:206352280-206352302 GGTCTCTCAAAACTTTCTGTGGG + Intronic
924651027 1:245927569-245927591 AGCCTCTCATATCCTTCCGTGGG - Intronic
924910394 1:248505801-248505823 CCCATTTCACATCTTTCTGTTGG + Intergenic
924913706 1:248542238-248542260 CCCATTTCACATCTTTCTGTTGG - Intergenic
1063668458 10:8080745-8080767 ACCCTCTCTCTTCTTACTGTTGG + Intergenic
1064503207 10:15997468-15997490 ACCTTTCCAAACCTTTCTGTGGG - Intergenic
1066016827 10:31254531-31254553 GAACTCTCAAATATTTCTGTTGG - Intergenic
1068360039 10:55966165-55966187 ACCCACACTAATCTTTCAGTAGG - Intergenic
1069989885 10:72308691-72308713 ACCCTCTGAAATCTTTGTTCGGG - Intergenic
1071236487 10:83656315-83656337 ACCTTCTACACTCTTTCTGTTGG + Intergenic
1072096105 10:92181967-92181989 ACTCTCTCAAATTTTCCTTTTGG - Intronic
1072456551 10:95581458-95581480 TCCCAGTCAAATCTTCCTGTTGG + Intergenic
1073175523 10:101554242-101554264 GCCATTTCAAATCTTTCTGTAGG - Exonic
1073857781 10:107697346-107697368 TCCCTCTAAAATCTTTCTAATGG + Intergenic
1078067448 11:8087697-8087719 ACCCTTTCAAGTCCGTCTGTGGG + Intronic
1079798399 11:24836987-24837009 ACCCTTTAAAGTCTTTCAGTAGG + Intronic
1080389301 11:31829477-31829499 CCTCCCTCAAATCTATCTGTAGG + Intronic
1080544188 11:33299591-33299613 ATCCTCTCAAACCTTGCTGCTGG - Intronic
1082831521 11:57622040-57622062 ACCCTATTTAATCTTTCTCTTGG + Intergenic
1086560643 11:88164521-88164543 ACCCTCTCAAACCTTTGAGCCGG - Intronic
1087794956 11:102446025-102446047 ATCCTCTCAGATCCCTCTGTTGG + Intronic
1088393607 11:109343078-109343100 ATCCTCTCAGAGCTTTCTGTGGG + Intergenic
1089349223 11:117812265-117812287 ATCCTTTCAAAGCTTGCTGTGGG - Intronic
1091152442 11:133341526-133341548 ACCCAGGCAAATCTTCCTGTAGG - Intronic
1097401417 12:59132865-59132887 ACACTCTCAAAACTTTTTGAGGG + Intergenic
1097615909 12:61883845-61883867 ACCTTCTCAAATCCTTGAGTTGG + Intronic
1100018593 12:90042485-90042507 ACCTTCTCATATCTTTCTTATGG + Intergenic
1100502735 12:95189834-95189856 ACTCTGTGAAATCTTTCTGTAGG - Intronic
1101855908 12:108442623-108442645 ACCCTCTCAACTCTATTTCTAGG + Intergenic
1101978380 12:109383082-109383104 AACCTCTCCCATGTTTCTGTGGG + Intronic
1104335056 12:127886647-127886669 ACCCTCTCTAAACTTTATGCTGG - Intergenic
1105502485 13:20984710-20984732 ACAATATTAAATCTTTCTGTCGG - Intronic
1105805708 13:23950664-23950686 GCCATCTTAAATCTTTCTCTTGG - Intergenic
1106493158 13:30247643-30247665 CTCCTCTCATTTCTTTCTGTTGG - Intronic
1107245223 13:38285996-38286018 ACTCTCTCATATCTTTTTATAGG - Intergenic
1108091091 13:46850661-46850683 TACCTATGAAATCTTTCTGTGGG + Intronic
1108415086 13:50189851-50189873 TTCCTCTCAAGTCTTTCTTTTGG - Intronic
1109958256 13:69597536-69597558 CTCCTCTCAAATCTTTCTGTGGG + Intergenic
1110476740 13:75924383-75924405 ATCCTGTCAAATCTTTCTAAGGG - Intergenic
1112622856 13:101069693-101069715 ACCCTCTCAAACCCTGCTGCTGG + Intronic
1112969592 13:105244105-105244127 GCCATCTCAAATCTGTATGTTGG + Intergenic
1114853424 14:26408293-26408315 TCCCTCACAAGTCTTTCAGTTGG - Intergenic
1115251587 14:31354141-31354163 ACCCTCCGTAATCTTCCTGTAGG - Intronic
1116090799 14:40303497-40303519 ATTCTCTCAAATCTGTCAGTGGG + Intergenic
1120385919 14:83845730-83845752 ATCCTCCAAATTCTTTCTGTTGG - Intergenic
1126357842 15:47815062-47815084 ACCCTCTCAAAGTTTTCAGCAGG + Intergenic
1127653770 15:61036132-61036154 AGCCTCTTAAAACTTTCTGGTGG + Intronic
1128822171 15:70667545-70667567 TATCTCTCAAATCTTTCTGAAGG + Exonic
1129117459 15:73372916-73372938 ATCATCTTAAAACTTTCTGTTGG + Intergenic
1131332026 15:91509741-91509763 CCACTCTCTAACCTTTCTGTTGG + Intergenic
1132812264 16:1806528-1806550 TTCCTCTCTAATCTTTCTTTAGG + Intronic
1133639363 16:7701958-7701980 ACCCTCTCAAATCTTTCTGTAGG + Intronic
1138253850 16:55533813-55533835 TCCCTCAAAAATCTTTCTTTAGG - Intronic
1138276939 16:55741957-55741979 AACCTCTGAAATCCTTCTGAGGG - Intergenic
1138282834 16:55785152-55785174 AACCTCTGAAATCCTTCTGAGGG - Intergenic
1138286101 16:55811471-55811493 AACCTCTGAAATCCTTCTGAGGG + Intronic
1139243249 16:65415995-65416017 ACCTTCTCAAGTATGTCTGTGGG + Intergenic
1140426117 16:74863070-74863092 ACTCTTTCAAAGCTTTTTGTGGG + Intergenic
1140615605 16:76659183-76659205 ACCATGTCAAGTCATTCTGTTGG + Intergenic
1146004322 17:29151346-29151368 ACCCTTGCAAATTGTTCTGTTGG + Intronic
1146446139 17:32934328-32934350 ACCCTCTCTTATTTCTCTGTGGG + Intronic
1147290380 17:39437581-39437603 ACCCTGGGATATCTTTCTGTTGG + Intronic
1150886086 17:69087695-69087717 ACCCTTTCAAATCTGTCAGCAGG + Intronic
1151540391 17:74761865-74761887 ACCCTCTCAAATTGCTGTGTAGG + Intronic
1151766598 17:76136305-76136327 ACCTGCTCAAAACTTTCTTTGGG - Intergenic
1152625418 17:81386003-81386025 ACCCTGACACATCTTTCCGTGGG + Intergenic
1154105286 18:11517557-11517579 ACTCTCTTAAATCCTTATGTGGG - Intergenic
1155254980 18:23987576-23987598 ACCCTCTCAAACATTCCTGGGGG + Intergenic
1155435944 18:25813235-25813257 AGCCTCCCCACTCTTTCTGTAGG - Intergenic
1159404110 18:67977499-67977521 ACTCTCTCAAATTTGTCTGCTGG - Intergenic
1159439041 18:68454558-68454580 AGCCTCTCAAACCCTTATGTTGG + Intergenic
1162193145 19:8962887-8962909 ATCCTCTCCAATGTGTCTGTGGG - Exonic
1163133376 19:15290880-15290902 AACCTCTCAAATGTTTCCTTGGG - Intronic
1166526401 19:43513113-43513135 AGCCTCTCAAATCTAGCTGGAGG - Intronic
1168105366 19:54162861-54162883 ACCCTGTCAATACTTTCTCTGGG + Intronic
1168508785 19:56958087-56958109 ACCCTCCCAGATCTGTCTGTTGG + Intergenic
925442556 2:3900890-3900912 CCCCTTTCAAACCTTGCTGTGGG + Intergenic
928188020 2:29132506-29132528 ACACCCTAAAATCTTTCTGAGGG + Intronic
929076542 2:38083479-38083501 ACCCTTTCAAAGCATGCTGTGGG + Intronic
929868621 2:45739160-45739182 ACCCTCTCGTATCATTCTGTAGG - Intronic
931880233 2:66561113-66561135 TCACTCTGAAATTTTTCTGTTGG - Intronic
931974900 2:67632647-67632669 ACTCTCTTATATGTTTCTGTAGG - Intergenic
932158415 2:69438718-69438740 ACCCTCTTAGATGTGTCTGTGGG - Intergenic
933270053 2:80223658-80223680 ACACTCTTTAATCTGTCTGTTGG + Intronic
936583740 2:113732060-113732082 TCCCTTTCCAATCTTTCTTTTGG + Intronic
941846328 2:170138037-170138059 TCACTCTCAAAACTTTCTGTGGG - Intergenic
943231448 2:185257908-185257930 ACCCTCTCACATTTCACTGTAGG + Intergenic
943887740 2:193243956-193243978 ACCTTTTCAAATATTTCTTTGGG - Intergenic
944763882 2:202844667-202844689 ACCCTCTCATTTCTTTCTAGAGG - Intronic
945333891 2:208569394-208569416 TTCCTCTCAAATCTTGATGTGGG - Intronic
946617722 2:221527657-221527679 ACCTTCTCAAATCCTTCTTAAGG + Intronic
1168924359 20:1566975-1566997 GTCATCTGAAATCTTTCTGTTGG + Intronic
1168928260 20:1600216-1600238 GCCATCTGAAATCTCTCTGTTGG + Intronic
1169939690 20:10923848-10923870 ACCCTCTGCAGTCTTTCTCTTGG - Intergenic
1170212650 20:13860709-13860731 TCCATCTCAACTCTTTCTCTGGG + Intronic
1171006769 20:21473670-21473692 ACCTTTTCAAAACTTTTTGTGGG - Intergenic
1172298785 20:33833204-33833226 ATTCTCCCAGATCTTTCTGTGGG - Intronic
1172701721 20:36857401-36857423 ATCCTCTCTAATCTGTCTGGAGG + Intronic
1175472568 20:59241330-59241352 AGCCTCTCAATGGTTTCTGTGGG - Intronic
1176410654 21:6447898-6447920 CCCCTCCCAACTCTTCCTGTGGG + Intergenic
1178500521 21:33122159-33122181 ACCCTCTAAATTCTTCTTGTGGG - Intergenic
1178549901 21:33528041-33528063 ACCCTCTGAAAGGTTTCTGATGG + Intronic
1178610713 21:34076402-34076424 ACACTCTGAAATCTTTCAATGGG - Intronic
1179266947 21:39812340-39812362 CCCCTCTGCAATCTTTCTGAGGG - Intergenic
1179686148 21:43056220-43056242 CCCCTCCCAACTCTTCCTGTGGG + Intronic
1181631500 22:24154013-24154035 ATCCACTCTACTCTTTCTGTGGG + Intronic
1184908425 22:47508772-47508794 ACCCTGCCAAATCTTTGTCTGGG + Intergenic
949689493 3:6619678-6619700 ACACTGTCAAATGTTTCTGGGGG - Intergenic
952786198 3:37157659-37157681 ACCTTCTATATTCTTTCTGTAGG - Intronic
956620227 3:71214505-71214527 ACCCTTTCAAAAGTTTCTTTGGG - Intronic
959049341 3:101509720-101509742 ACTTTCTTAAATCTTTCAGTAGG - Intronic
959581511 3:107987707-107987729 ACATTCTCAAATCTATTTGTGGG + Intergenic
959751586 3:109843103-109843125 TCCAACTCAAATATTTCTGTAGG - Intergenic
960279179 3:115762043-115762065 ACCTTCTCATACCTTTCTGGGGG + Intergenic
960429895 3:117556572-117556594 ACCATATCAAGTCTTTTTGTAGG - Intergenic
961184976 3:124906788-124906810 ACGATCTCATATGTTTCTGTTGG - Intronic
963663480 3:148154648-148154670 ACCCTTTCAAAGCTTGCTGTGGG - Intergenic
964555109 3:157928504-157928526 GCCCTAGCAAATTTTTCTGTAGG + Intergenic
964847112 3:161056088-161056110 CCCCCCTCCAACCTTTCTGTAGG - Intronic
971915494 4:32865619-32865641 ACTATCTCAAATATCTCTGTTGG - Intergenic
972560849 4:40227229-40227251 ACACAATAAAATCTTTCTGTGGG + Intronic
972575737 4:40349532-40349554 ACTGTCTCAAATTTTTCTGGTGG + Intronic
975771630 4:77730086-77730108 AGCGTCTCAAATTTTTCTATTGG + Intronic
981537777 4:145817746-145817768 ACCTTCTCATCTCTTTCTATAGG + Intronic
981764982 4:148239003-148239025 AGCCTCTCCCATCTGTCTGTTGG - Intronic
983889701 4:173017835-173017857 ACACTGGCAAATCTGTCTGTTGG - Intronic
984034989 4:174655577-174655599 AGACTCTCTAATCTTTCTCTGGG - Intronic
987267612 5:16274344-16274366 ACAGTCTCAAATTTTACTGTAGG - Intergenic
993670108 5:90749971-90749993 ATCCTCGGAAATGTTTCTGTGGG - Intronic
993810635 5:92471286-92471308 ACCCTTTTAAATCTTTCTTGTGG + Intergenic
993922475 5:93824076-93824098 CCCCTCTCCTTTCTTTCTGTTGG - Intronic
996105122 5:119492322-119492344 ACCCTATCTATTCTTCCTGTAGG + Intronic
999347984 5:150841094-150841116 ACCCTCTCTAATATTCCTTTTGG + Intergenic
999835743 5:155369111-155369133 ATCCTCTCCAACCTTTCAGTTGG + Intergenic
1001144430 5:169171492-169171514 AACCTCTGGAATCTTGCTGTTGG - Intronic
1005790053 6:29290786-29290808 CCCCTCTGTAATCTTTCTGGTGG + Intergenic
1007352183 6:41282025-41282047 CCCCTCTCACATCTTTCTGTGGG - Intronic
1009135180 6:59526465-59526487 ACCATCTCTAACCTTTCTTTTGG + Intergenic
1009509380 6:64529876-64529898 TCCATCTCAATTCTTTCTGCTGG - Intronic
1009948157 6:70364154-70364176 ACCCTCCCAGATGTTGCTGTTGG - Intergenic
1011740334 6:90353314-90353336 ATCCTTTCAAATCTTTTTGAAGG + Intergenic
1011936231 6:92781635-92781657 ACCCACTCAACTCTAACTGTAGG - Intergenic
1012084263 6:94803704-94803726 ATCCTCTCAAATTTTGCTGCTGG - Intergenic
1013626673 6:111944605-111944627 AAGCTGTCAAATCTTTCTGGAGG + Intergenic
1014096187 6:117464745-117464767 ACCCTCTTAATTCGCTCTGTGGG - Intronic
1015034110 6:128631705-128631727 ACGCTCAGAAATCTTTCAGTAGG - Intergenic
1015601355 6:134914348-134914370 ATCCCCTCACATCTTTCTGAGGG + Intergenic
1016718459 6:147263520-147263542 ACTCTTTCAAAGCTTTCAGTGGG + Intronic
1018334881 6:162776488-162776510 ACCCCCTCAGATCCTTCTCTGGG + Intronic
1018793289 6:167166779-167166801 TTTCTTTCAAATCTTTCTGTAGG - Intronic
1020225178 7:6273715-6273737 CCCCTCCCAAGCCTTTCTGTTGG + Intergenic
1022630291 7:32078323-32078345 ACTGTCTCTAAACTTTCTGTGGG + Intronic
1022788941 7:33667397-33667419 ACTCTGTAAGATCTTTCTGTAGG - Intergenic
1027945236 7:84736176-84736198 ACCCACTCATTTCTTTTTGTTGG + Intergenic
1031696211 7:124857933-124857955 ACCCTCTCAGATGCTGCTGTGGG + Intronic
1035700732 8:1637905-1637927 AGCCTCTCAACTCTTCCTGCAGG - Intronic
1037148793 8:15609512-15609534 ACTCTTTCATATCCTTCTGTTGG - Intronic
1039629689 8:39097181-39097203 AGCCTCTCAAATCTTTTTTGGGG + Intronic
1041312982 8:56535367-56535389 CCCCTGTAAAATATTTCTGTTGG - Intergenic
1043228031 8:77758967-77758989 GCCTTCTCAGATCTTTCTTTGGG + Intergenic
1043833907 8:85022967-85022989 TCCCTCTAAAATCTTGCAGTGGG + Intergenic
1045038021 8:98192555-98192577 GCGCTCTCAAACCTTTCTTTTGG + Exonic
1046860608 8:119087041-119087063 TCCATCTCAAAGCTTGCTGTGGG + Intronic
1047090483 8:121568983-121569005 TCCCTCTAAAAACTTTCTGGTGG + Intergenic
1047317225 8:123745764-123745786 TCCCTCTCAACTCTTCCTTTGGG - Intergenic
1047829414 8:128614631-128614653 ATCCTTTCAAAGCTTGCTGTGGG + Intergenic
1048026919 8:130595822-130595844 ACCCTCAGAAACATTTCTGTAGG - Intergenic
1048245719 8:132796607-132796629 TGTCTCTCAACTCTTTCTGTAGG - Intronic
1048250146 8:132858844-132858866 ACCCTCTGAAATCTTACCCTTGG - Intergenic
1052007940 9:23372952-23372974 ACCCTCTCAAGTAATTATGTTGG + Intergenic
1052069221 9:24060817-24060839 ACTCTTTGAATTCTTTCTGTAGG + Intergenic
1053509475 9:38675446-38675468 CACCTCTCAAAGTTTTCTGTGGG - Intergenic
1055141911 9:72886169-72886191 ATCCTCTAAAATCCATCTGTGGG - Intergenic
1057249581 9:93489672-93489694 AGCCTTTCAAATCTTTATTTAGG + Intronic
1057935255 9:99233001-99233023 TCCTTTTCAATTCTTTCTGTGGG - Intergenic
1058145501 9:101406526-101406548 CCCCTCTCAAATTTTTCAGTGGG - Intronic
1059849916 9:118326517-118326539 ACCCTCCACAATCTTTCTGGTGG + Intergenic
1187265436 X:17727914-17727936 ACCCTCTGAAATCCTTCTGTGGG - Exonic
1188311665 X:28624882-28624904 ACACTTTCAAAGCTTTCTTTAGG + Intronic
1189306618 X:39991571-39991593 AGCCTCACAAATCTCTCTGAGGG - Intergenic
1189592937 X:42534665-42534687 ATCTTCTCATATTTTTCTGTGGG - Intergenic
1190616529 X:52239577-52239599 ATCCTCTCAGATCTTTTTGTGGG + Intergenic
1194162152 X:90467289-90467311 ACCCTCTCAACTTCTGCTGTGGG - Intergenic
1197666912 X:129234078-129234100 CCCCTGTCAAATCTTGCTTTTGG - Intergenic
1198133794 X:133726690-133726712 AGGTTCACAAATCTTTCTGTTGG + Intronic
1199193856 X:145003993-145004015 ACCCTCTGTAATCATACTGTTGG - Intergenic
1200508429 Y:4045026-4045048 ACCCTCTCAACTTCTGCTGTGGG - Intergenic