ID: 1133639365

View in Genome Browser
Species Human (GRCh38)
Location 16:7701959-7701981
Sequence CCCTCTCAAATCTTTCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133639357_1133639365 20 Left 1133639357 16:7701916-7701938 CCTGTTGCAGCAAACCAGGGTGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1133639365 16:7701959-7701981 CCCTCTCAAATCTTTCTGTAGGG 0: 1
1: 0
2: 1
3: 7
4: 209
1133639362_1133639365 -7 Left 1133639362 16:7701943-7701965 CCTGAGGTTCTGGAAACCCTCTC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1133639365 16:7701959-7701981 CCCTCTCAAATCTTTCTGTAGGG 0: 1
1: 0
2: 1
3: 7
4: 209
1133639360_1133639365 6 Left 1133639360 16:7701930-7701952 CCAGGGTGCATGGCCTGAGGTTC 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1133639365 16:7701959-7701981 CCCTCTCAAATCTTTCTGTAGGG 0: 1
1: 0
2: 1
3: 7
4: 209
1133639356_1133639365 21 Left 1133639356 16:7701915-7701937 CCCTGTTGCAGCAAACCAGGGTG 0: 1
1: 0
2: 1
3: 17
4: 126
Right 1133639365 16:7701959-7701981 CCCTCTCAAATCTTTCTGTAGGG 0: 1
1: 0
2: 1
3: 7
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133639365 Original CRISPR CCCTCTCAAATCTTTCTGTA GGG Intronic
901855059 1:12039224-12039246 TCCTCTCAAAACTTCCTGCAAGG - Intergenic
903323582 1:22556609-22556631 CCCTCCCCAAGCTTTCTGGAAGG - Intergenic
903650684 1:24919809-24919831 CCCTTTCAGCTCTTTTTGTATGG + Intronic
907938515 1:59064738-59064760 TCCTCTTTAATCTTTCTGTGGGG - Intergenic
908065219 1:60396086-60396108 CCTTCTCAAATCTTGCTTTCTGG - Intergenic
910158130 1:84243750-84243772 ACCTCTCAATTTTTTCTTTATGG + Intergenic
910858187 1:91717341-91717363 CCCTAAGAAATCTTTCTCTATGG + Intronic
910863655 1:91767816-91767838 ACTTCTCAATTCTTTCTGGAAGG + Intronic
911035946 1:93547944-93547966 GCCTCTCACATTTTTCTCTAAGG - Intronic
912167751 1:107060333-107060355 CACTGTCCAATCTGTCTGTATGG + Intergenic
915043369 1:152987662-152987684 TCTTCTAAAATCATTCTGTAAGG + Intergenic
918216716 1:182398071-182398093 TCCTCACAAATGTTTCTATAAGG - Intergenic
918593562 1:186266940-186266962 CTCTCTCAAAACTTTAAGTAAGG + Intergenic
920609071 1:207419715-207419737 CACTCTCAGATATTTCTTTATGG + Intergenic
924599100 1:245472637-245472659 CTCTCTCAAATCTCTTTGGAGGG - Intronic
1063364949 10:5485055-5485077 CCCTCCCAAATGTTTCCCTAAGG + Intergenic
1065592515 10:27279750-27279772 CTCTATCAAATCTTTCTGCTTGG - Intergenic
1066016826 10:31254530-31254552 AACTCTCAAATATTTCTGTTGGG - Intergenic
1066403861 10:35100783-35100805 CCCTGTCAATTTTTACTGTAGGG - Intergenic
1066409113 10:35148744-35148766 CCCTCTCAAATCATACTTTGAGG - Intronic
1066755909 10:38713096-38713118 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
1068932058 10:62601332-62601354 CCTTCTCAAGCCCTTCTGTAAGG + Intronic
1072004190 10:91227295-91227317 GCCTCTCAAATCTTTATTTTTGG + Intronic
1073857783 10:107697347-107697369 CCCTCTAAAATCTTTCTAATGGG + Intergenic
1078867647 11:15312698-15312720 CCCACTCCAATGTATCTGTAAGG + Intergenic
1083143080 11:60737735-60737757 CCCTCTCCACTTTCTCTGTATGG + Intronic
1085189138 11:74602663-74602685 CCTTCTCAGATCCTTCTGAAAGG + Intronic
1086287617 11:85267171-85267193 TCCTCTCATGTCTTTTTGTAAGG - Intronic
1086940291 11:92790469-92790491 CCCTCTCAAGTCAGTCTGTTTGG - Intronic
1087882003 11:103427692-103427714 CCCTCTCATATCTTTTTACAAGG + Intronic
1087958221 11:104316121-104316143 CCCTCTCAACCCCTTCAGTAAGG - Intergenic
1091152440 11:133341525-133341547 CCCAGGCAAATCTTCCTGTAGGG - Intronic
1092359904 12:7827808-7827830 CCCTCTCACCTCATTCTTTAGGG + Intronic
1093762081 12:22921999-22922021 TCCTCTCAAATCCTTTTATATGG + Intergenic
1099092560 12:78331822-78331844 CACTCTGAATTCTTTCTGCATGG + Intergenic
1099269964 12:80496442-80496464 CCCTCTATAACATTTCTGTAAGG + Exonic
1099547529 12:84004033-84004055 ACCTCTAAACTCATTCTGTAAGG - Intergenic
1100502734 12:95189833-95189855 CTCTGTGAAATCTTTCTGTAGGG - Intronic
1100688738 12:97015582-97015604 CCGTCTCAAATCTGTTTGTTAGG - Intergenic
1101385330 12:104252255-104252277 CCCTTTCAGATATGTCTGTAGGG + Intronic
1102325477 12:111978632-111978654 CCCTCTCATGTCTTTTTATAAGG - Intronic
1103158068 12:118704525-118704547 CCCTCTTAAAAATTTCTGCATGG - Intergenic
1105711238 13:23011249-23011271 CTCTTTGAAATATTTCTGTATGG + Intergenic
1105805706 13:23950663-23950685 CCATCTTAAATCTTTCTCTTGGG - Intergenic
1105915265 13:24909565-24909587 CCCTGCCAGCTCTTTCTGTATGG - Intronic
1106784606 13:33094235-33094257 CCGTCTCAGATATTTCTTTATGG - Intergenic
1107245222 13:38285995-38286017 CTCTCTCATATCTTTTTATAGGG - Intergenic
1107368124 13:39708538-39708560 CCATCTCAAATTTTTGAGTATGG + Intronic
1108091092 13:46850662-46850684 ACCTATGAAATCTTTCTGTGGGG + Intronic
1110081280 13:71316461-71316483 CCCCATCATATCTTTCTGCAAGG + Intergenic
1110883472 13:80602439-80602461 CCAAATCAAATCTTACTGTAGGG + Intergenic
1111708244 13:91778441-91778463 CCATCTCCATTCTTTCTGTATGG + Intronic
1117020893 14:51569209-51569231 GCCTCTCAGACATTTCTGTATGG + Intronic
1118901650 14:69991314-69991336 CCCTCTCCAAGCCTTCTCTAAGG + Intronic
1119130971 14:72173025-72173047 TCCTCTCAAATCACTCTGAATGG - Intronic
1120329472 14:83072259-83072281 CACTCTCAAAACTGTCTGTTTGG + Intergenic
1120983286 14:90310243-90310265 CCCTGTCTCATCTTTCTGCATGG + Intronic
1121316502 14:92964158-92964180 ACCCCCCAAATCTTTCTGTTTGG - Intronic
1122893245 14:104742642-104742664 CCCTCTCAAGCCTCTCTGGATGG - Intronic
1123440173 15:20285150-20285172 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
1124015478 15:25870535-25870557 CCCTCTCAATTTATTCTGCAAGG + Intergenic
1125424718 15:39537354-39537376 CCCTCATAATTCTTTCTGCATGG + Intergenic
1126495073 15:49281133-49281155 ACCACTCAAATCTTTCTTCATGG - Intronic
1128822172 15:70667546-70667568 ATCTCTCAAATCTTTCTGAAGGG + Exonic
1133168003 16:3962298-3962320 CCCCCTCAATTCCTTCTCTAAGG + Intronic
1133639365 16:7701959-7701981 CCCTCTCAAATCTTTCTGTAGGG + Intronic
1133757734 16:8775217-8775239 CCCTCCCAGCTCTCTCTGTAAGG + Intronic
1133896626 16:9935618-9935640 CACTCTGAAATATTTCTGGAAGG - Intronic
1136726769 16:32363774-32363796 CCCTCTCTGCTCTTTCTGGATGG - Intergenic
1136844999 16:33569286-33569308 CCCTCTCTGCTCTTTCTGGATGG - Intergenic
1138979837 16:62254286-62254308 CCCTCTCAAATTCTTTTGTGTGG + Intergenic
1202999665 16_KI270728v1_random:153984-154006 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
1203106707 16_KI270728v1_random:1417939-1417961 CCCTCTCTGCTCTTTCTGGATGG - Intergenic
1203131263 16_KI270728v1_random:1690384-1690406 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
1203155167 16_KI270728v1_random:1869584-1869606 CCCTCTCTGCTCTTTCTGGATGG - Intergenic
1144355594 17:14443160-14443182 CCCCCTCAGATCTTTCTCCAGGG + Intergenic
1146268537 17:31469245-31469267 CCCTCTTAAAGCTTTCGGTCTGG + Intronic
1151373303 17:73664680-73664702 CCCTTTGAAATCTTTGTGAAAGG + Intergenic
1151540393 17:74761866-74761888 CCCTCTCAAATTGCTGTGTAGGG + Intronic
1155435943 18:25813234-25813256 GCCTCCCCACTCTTTCTGTAGGG - Intergenic
1156748521 18:40421598-40421620 CCCTCTTATTTCTCTCTGTAGGG + Intergenic
1158129397 18:54136171-54136193 ACCTCTCAATTCTGTCTGTGTGG - Intergenic
1158337499 18:56429351-56429373 CCTTCTCAACTCATTGTGTAAGG + Intergenic
1160018587 18:75163326-75163348 CCCTCTCAAATCCCACTTTATGG + Intergenic
1160127164 18:76186170-76186192 TCCTCTTAAATCCTTCTGGAAGG + Intergenic
1160956720 19:1696883-1696905 CCCTCTGCAAACTTTCTATAAGG - Intergenic
1161351446 19:3794332-3794354 CCCTCTCATCTGCTTCTGTAAGG - Intronic
1167355584 19:49001909-49001931 CCCTAGCAAATCTTTCTTAAAGG + Intronic
1168014438 19:53560945-53560967 ACCTCTCAAATGTGTCTCTATGG - Intronic
1168508787 19:56958088-56958110 CCCTCCCAGATCTGTCTGTTGGG + Intergenic
925127118 2:1466399-1466421 CCTTCCTAAATCATTCTGTAAGG - Intronic
931115010 2:59156044-59156066 CCAGCACAAATATTTCTGTATGG + Intergenic
931806165 2:65807593-65807615 TCCTCTGAAATCTATGTGTAAGG - Intergenic
931847722 2:66222077-66222099 CCCTCTCACACCTTTCTCTATGG + Intergenic
931861098 2:66355521-66355543 ACCTTTCAAATGTTTTTGTATGG + Intergenic
931974899 2:67632646-67632668 CTCTCTTATATGTTTCTGTAGGG - Intergenic
932516072 2:72350948-72350970 CCCTCACAAATGCTTTTGTAGGG + Intronic
934319212 2:91957335-91957357 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
934772771 2:96918218-96918240 CCTTTTTAAATCTTTATGTATGG - Intronic
935729955 2:106057091-106057113 CCCGATCAATTCTTTCTTTAGGG + Intergenic
937626683 2:124051912-124051934 CCCTCCCAAATCTCTCTTTCTGG + Intronic
942009842 2:171750434-171750456 TCCATTCAAGTCTTTCTGTATGG - Intergenic
942332328 2:174839902-174839924 CCCTCTTAAATATTTAAGTAAGG - Intronic
943101881 2:183496822-183496844 ACCTCACAAATTTTTCTGAATGG + Intergenic
946107685 2:217386327-217386349 CTATCTAAACTCTTTCTGTAAGG + Intronic
946184113 2:217967800-217967822 ACCTCTCAAATCATTCTATGAGG + Intronic
947216891 2:227758095-227758117 ACCTCTCAAAGCTCTCTGCAAGG - Intergenic
948085486 2:235243335-235243357 CCCTCTCCAAACCTTCTGGAAGG + Intergenic
948507888 2:238442414-238442436 ATCTCTCTAATTTTTCTGTAGGG + Intronic
1169084043 20:2816066-2816088 CTCTCGCAAGTCTTTCTGTCTGG - Intergenic
1169625927 20:7569001-7569023 GACTCTCAAATTTTTCTGTTTGG - Intergenic
1171006500 20:21470963-21470985 CCCTCTCCTAGCTTTCTGAATGG - Intergenic
1171329306 20:24323636-24323658 CCCTCCCAAATTTGCCTGTAAGG - Intergenic
1171369733 20:24653864-24653886 CCCTGTCATCTCTTCCTGTAAGG + Intronic
1173097705 20:40052764-40052786 CAGTCTCTAATCTGTCTGTATGG + Intergenic
1173741184 20:45403566-45403588 CCCTCTCCATTCCTTCTTTATGG + Intronic
1173823591 20:46033417-46033439 GCCTCTTATATCTTTCTGAAGGG + Intronic
1173889106 20:46490447-46490469 CCCTTTAAAATATTTCTGTGTGG - Intergenic
1175439155 20:58978681-58978703 CCTTCTCACTTCCTTCTGTAAGG + Intergenic
1176992665 21:15517580-15517602 CTCTCTGAAATCTTTCTCTATGG - Intergenic
1177483256 21:21721303-21721325 GCTTCTCAAATCTTTCTCCATGG + Intergenic
1179266945 21:39812339-39812361 CCCTCTGCAATCTTTCTGAGGGG - Intergenic
1180307391 22:11140981-11141003 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
1180545911 22:16503204-16503226 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
1182213264 22:28694196-28694218 CCCTCTCTGCTCTTTCTGAATGG - Intronic
1184316859 22:43700359-43700381 CACTCTCAAATCATTTTGTTAGG + Intronic
951003325 3:17590560-17590582 CCCTCACAAATCTGTTTGCAAGG - Intronic
952106366 3:30074349-30074371 CTCTCTCAAATATTTCAGTCTGG + Intergenic
953563156 3:44010782-44010804 TCCTCTGAAATCTGTCTTTATGG + Intergenic
955753848 3:62208349-62208371 CACTCTGAAATGTTTTTGTAGGG - Intronic
957285994 3:78218510-78218532 TCCCCACATATCTTTCTGTAGGG + Intergenic
957938304 3:86971797-86971819 GCCTCTCTAAACTCTCTGTATGG - Intronic
962672251 3:137720720-137720742 CCCTTCCTAATCTTTCTATATGG + Intergenic
966691667 3:182747930-182747952 CCGTCTCAAATCTACCTGGATGG + Intergenic
967526123 3:190494847-190494869 CCCTCTCAAATGTTACTATTTGG + Intergenic
968835153 4:2958361-2958383 TCCTCTCACAGCTTTCTTTAGGG - Intronic
969034439 4:4241690-4241712 GCCTCTGAAATCTGTCTGTATGG + Intronic
970251877 4:14125390-14125412 CATTGTCAAATCTTTCTGAAAGG - Intergenic
971225747 4:24750122-24750144 CACTCTCAGATCTTTGTGTTTGG - Intergenic
972041690 4:34608851-34608873 CCCTCTCAAATGTTACTTTCTGG + Intergenic
976135369 4:81930314-81930336 CTCTCCCAAATCTTTTTGTTTGG - Intronic
976314617 4:83646045-83646067 TCGTCTCAAATGTTTCTGGAGGG - Intergenic
977200189 4:94106012-94106034 CCCTCTCATTTCTTCCTGCATGG - Intergenic
977232865 4:94472935-94472957 CCCTCTCAAATCTATGTTTTAGG + Intronic
978975541 4:114865543-114865565 ACTTATCAAATGTTTCTGTAAGG + Intronic
981571710 4:146158633-146158655 CCCTATAAAATGTTTCTATATGG - Intergenic
982088509 4:151860777-151860799 CCCTTGCATATCTTTCTGGAGGG + Intergenic
982297028 4:153839669-153839691 ACCTGTAAAGTCTTTCTGTATGG - Intergenic
983106987 4:163699132-163699154 GCCTCTCAAATATCTCTGAAGGG + Intronic
986348460 5:6855735-6855757 CTCTCTCATGTCTTTTTGTAAGG + Intergenic
988011772 5:25497510-25497532 ATCTCTCAAATCTTTCTGAGTGG - Intergenic
990885638 5:60589250-60589272 CTCTTTCAAAATTTTCTGTATGG + Intergenic
992091629 5:73322815-73322837 GCCTGTCAAATATTTGTGTAGGG + Intergenic
994881597 5:105504932-105504954 CCCTCTCACTTCTTTTTGGAAGG + Intergenic
996451426 5:123629470-123629492 GCCACTCAAAGCTTTTTGTATGG - Intergenic
1001114114 5:168924389-168924411 CCCTCTCAAACCCTTCTTTTAGG + Intronic
1001556959 5:172643103-172643125 CCCTCTCAACTCTCTCTCTGTGG + Intronic
1006329785 6:33382173-33382195 TCCTCTCAAAGCTTTCAGGAAGG - Intergenic
1010434895 6:75817580-75817602 CCATCTGAAATCCATCTGTAGGG - Exonic
1010697684 6:78997299-78997321 TCCTCTGAAATTTTTCTGGAAGG - Intronic
1010703989 6:79086124-79086146 CATTCTAAATTCTTTCTGTATGG + Intergenic
1011740335 6:90353315-90353337 TCCTTTCAAATCTTTTTGAAGGG + Intergenic
1012744600 6:103069357-103069379 TCCTATTTAATCTTTCTGTATGG - Intergenic
1012949048 6:105498165-105498187 TTCTTTCAAATCTTTCTTTAAGG - Intergenic
1014296908 6:119629540-119629562 TCCTCTAAAAGCATTCTGTAGGG - Intergenic
1015745014 6:136500361-136500383 CCTTCTCAATTCCTTCTTTATGG + Intronic
1018018358 6:159733310-159733332 CCCTCTTTAATCTTTCTCAAGGG - Intronic
1018465081 6:164036639-164036661 TCCTCTGAAATCTTGCTGTCTGG - Intergenic
1018653381 6:166009709-166009731 CCCTCTCAATTATTTTTGCACGG + Intergenic
1020648840 7:10850302-10850324 TCCTCTTTAATCTTTGTGTAGGG + Intergenic
1022210910 7:28208482-28208504 CACACACACATCTTTCTGTATGG + Intergenic
1023898462 7:44454624-44454646 CCTTCTCAAAACTTTCTTTTAGG + Intronic
1024926749 7:54624044-54624066 CCCTTTCAAATTATTCTGTGAGG + Intergenic
1027794636 7:82677192-82677214 CTGTCACAAATCTTTGTGTAAGG + Intergenic
1027970597 7:85075669-85075691 CTCAGTCAAATTTTTCTGTAGGG + Intronic
1031426344 7:121610120-121610142 CCTTCTCAACTCTTCCTCTAAGG + Intergenic
1032914825 7:136478207-136478229 TGTTCTCAAATCTTTCTGCATGG + Intergenic
1037800821 8:22034315-22034337 CCCTCTTAAGTGCTTCTGTAGGG - Intronic
1038818423 8:30930366-30930388 GCCTGTCAAATCTTTGTGTTTGG + Intergenic
1039973203 8:42338068-42338090 CACTGTCAAAACTTTCTCTAAGG - Intergenic
1041255762 8:55978627-55978649 CCCTCTCAGCCCTTTCTTTAGGG - Intronic
1041681322 8:60595668-60595690 CACTGTCACATCTTTCTGGAGGG - Intronic
1041947854 8:63466697-63466719 CCCTCTCAAAACTTCCCCTAAGG - Intergenic
1042682859 8:71405897-71405919 GCCTCTCAAATCTTAATATATGG + Intronic
1043997639 8:86838354-86838376 TCCTCTGAGATTTTTCTGTAAGG - Intergenic
1045038022 8:98192556-98192578 CGCTCTCAAACCTTTCTTTTGGG + Exonic
1046860610 8:119087042-119087064 CCATCTCAAAGCTTGCTGTGGGG + Intronic
1047317223 8:123745763-123745785 CCCTCTCAACTCTTCCTTTGGGG - Intergenic
1047996865 8:130345250-130345272 ACCTCTCAGATTTTTCTTTATGG - Intronic
1048026917 8:130595821-130595843 CCCTCAGAAACATTTCTGTAGGG - Intergenic
1048245718 8:132796606-132796628 GTCTCTCAACTCTTTCTGTAGGG - Intronic
1050589924 9:7150211-7150233 CCCTTTCACCTCTTTCTTTAAGG + Intergenic
1051383009 9:16477961-16477983 CCCGCTCAAGTCTTTTTCTAAGG - Intronic
1051756804 9:20409735-20409757 CCCTACCAAATTCTTCTGTAGGG + Intronic
1053509474 9:38675445-38675467 ACCTCTCAAAGTTTTCTGTGGGG - Intergenic
1053863212 9:42408878-42408900 CCTGCTCAAACCTTTCTGGAAGG - Intergenic
1054710699 9:68508163-68508185 CCATCTCAAATCTCTCTTTGTGG + Intronic
1055534167 9:77219412-77219434 TCCTCTCAACTCTTTGTGTTTGG - Intronic
1056569275 9:87801875-87801897 TGCTCTCAAATATTTCTGAAGGG + Intergenic
1057131512 9:92657488-92657510 CCCTGTCAGATCTTCCTGTGTGG - Intronic
1057935253 9:99233000-99233022 CCTTTTCAATTCTTTCTGTGGGG - Intergenic
1059934327 9:119293340-119293362 ACCTCTAGAATCTTTATGTATGG + Intronic
1060647070 9:125290017-125290039 CCATCTCAAATGCTTCTGTTAGG + Intronic
1187723414 X:22175649-22175671 CCATCTCAAAACTTTCTAAAGGG - Intronic
1188738516 X:33747913-33747935 CCTCCCCAAATCTTTCTGTGAGG - Intergenic
1192941436 X:75916686-75916708 CACTCTCAAATCATTCTGTAAGG + Intergenic
1193515800 X:82461591-82461613 CCCTGTCAAATCTTTATCAAAGG + Intergenic
1195708525 X:107756083-107756105 CCATCTCAAACCATACTGTACGG + Intronic
1198525196 X:137493517-137493539 GCCTCACCAATTTTTCTGTAAGG + Intergenic
1198570870 X:137955294-137955316 CCCTCACAAAACTTTCTTTTAGG - Intergenic
1199581687 X:149366870-149366892 CCATCTCAAATCATTCTTTTTGG + Intergenic
1201186748 Y:11412448-11412470 CCCTCTCTGCTCTTTCTGGATGG + Intergenic
1201378645 Y:13348186-13348208 CTCTCATAAATTTTTCTGTAAGG - Intronic
1202076724 Y:21044003-21044025 CCCTCTCACACTTTTCTTTAGGG - Intergenic
1202164550 Y:21972712-21972734 GCCTCTCAAAATTTTCTGTCTGG - Intergenic
1202226806 Y:22613660-22613682 GCCTCTCAAAATTTTCTGTCTGG + Intergenic
1202316314 Y:23582000-23582022 GCCTCTCAAAATTTTCTGTCTGG - Intergenic
1202554450 Y:26088058-26088080 GCCTCTCAAAATTTTCTGTCTGG + Intergenic