ID: 1133639367

View in Genome Browser
Species Human (GRCh38)
Location 16:7701965-7701987
Sequence CAAATCTTTCTGTAGGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133639357_1133639367 26 Left 1133639357 16:7701916-7701938 CCTGTTGCAGCAAACCAGGGTGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1133639367 16:7701965-7701987 CAAATCTTTCTGTAGGGCAGAGG 0: 1
1: 0
2: 1
3: 24
4: 199
1133639362_1133639367 -1 Left 1133639362 16:7701943-7701965 CCTGAGGTTCTGGAAACCCTCTC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1133639367 16:7701965-7701987 CAAATCTTTCTGTAGGGCAGAGG 0: 1
1: 0
2: 1
3: 24
4: 199
1133639360_1133639367 12 Left 1133639360 16:7701930-7701952 CCAGGGTGCATGGCCTGAGGTTC 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1133639367 16:7701965-7701987 CAAATCTTTCTGTAGGGCAGAGG 0: 1
1: 0
2: 1
3: 24
4: 199
1133639356_1133639367 27 Left 1133639356 16:7701915-7701937 CCCTGTTGCAGCAAACCAGGGTG 0: 1
1: 0
2: 1
3: 17
4: 126
Right 1133639367 16:7701965-7701987 CAAATCTTTCTGTAGGGCAGAGG 0: 1
1: 0
2: 1
3: 24
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133639367 Original CRISPR CAAATCTTTCTGTAGGGCAG AGG Intronic
901636231 1:10671544-10671566 CAAGTGTCTCTGGAGGGCAGTGG + Intronic
904797644 1:33069433-33069455 CAAATTTTTTTGTAGAGAAGAGG - Intronic
905782365 1:40723450-40723472 CAGATACTTCTGTGGGGCAGAGG + Intronic
906222293 1:44090500-44090522 CAAATCTTTGTGGAGAGCAAGGG + Intergenic
907827539 1:58033145-58033167 CAAATCCATCTGGAGAGCAGAGG - Intronic
908520152 1:64933796-64933818 AAAAACTTTCTTTAGAGCAGCGG - Intronic
908758288 1:67489178-67489200 CAAGTCCTTATCTAGGGCAGTGG - Intergenic
908934424 1:69357492-69357514 TAAATCTTTATGGAAGGCAGAGG + Intergenic
913609228 1:120493994-120494016 CACATGTTTCTGTGGGGCTGAGG + Intergenic
914581964 1:149027845-149027867 CACATGTTTCTGTGGGGCTGAGG - Intronic
915064405 1:153212755-153212777 CCAATCTTGCTGGAGGGCTGGGG + Intergenic
915782272 1:158566000-158566022 CAAATCCTTTTGCAGGTCAGTGG - Intergenic
917568632 1:176238564-176238586 GAAATTTTTCTGTAGAGAAGGGG + Intergenic
920283864 1:204865416-204865438 CAAAACTTTCAATAAGGCAGGGG + Intronic
920946790 1:210536746-210536768 CAAATCCTGCTGTATGGCAAAGG - Intronic
921105336 1:211971287-211971309 CAAAGGTTTCTCTAGGACAGTGG - Intronic
924683300 1:246260206-246260228 CAACTCTTCCTGTGGGACAGTGG - Intronic
1063013740 10:2053211-2053233 CAAAGCTTTCTCTAGGGGATGGG - Intergenic
1063259571 10:4370797-4370819 CAAATCTTTCTTCTGGGCAAAGG - Intergenic
1063268157 10:4476602-4476624 CTCACCTTCCTGTAGGGCAGCGG - Intergenic
1065577043 10:27131676-27131698 CAAATCTTGCTTTATGGCAGGGG - Intronic
1067489778 10:46687643-46687665 CAACTCATTCTGTGGGTCAGTGG + Intergenic
1067604890 10:47652741-47652763 CAACTCATTCTGTGGGTCAGTGG - Intergenic
1069359245 10:67623323-67623345 CAAATCTGTCTGTAGAGCAGTGG + Intronic
1070537931 10:77393287-77393309 CAAATCCTTTTCTGGGGCAGGGG - Intronic
1071620444 10:87114151-87114173 CAACTCATTCTGTGGGTCAGTGG - Intronic
1071872997 10:89815626-89815648 TAAATTTTTCTGTAGAGAAGGGG + Intergenic
1072445841 10:95497779-95497801 CAAATATGACTGTGGGGCAGAGG - Intronic
1072649872 10:97286695-97286717 GAAATGTTTCTGGAGGACAGGGG - Intronic
1073431104 10:103487818-103487840 CAAGTTTGTCTGTGGGGCAGAGG + Intergenic
1075261469 10:120966863-120966885 CCAATCTGTCTGCAGGGCTGTGG + Intergenic
1075285412 10:121181059-121181081 CAAATCTTTCTGTAGAAAAATGG - Intergenic
1076214266 10:128680170-128680192 CAAAGCTTTCTCATGGGCAGAGG - Intergenic
1076597686 10:131635910-131635932 CAATCCTTTCTGGAGGGCTGGGG + Intergenic
1079884869 11:25974704-25974726 CAAATATTTTTGTGGGGTAGAGG - Intergenic
1081353527 11:42085219-42085241 CAAATCATGCTGGAGGGCAAAGG + Intergenic
1083961525 11:66017349-66017371 CAAGTCTGCCTGTAGCGCAGAGG + Intronic
1084728790 11:71059997-71060019 CTGACCTTCCTGTAGGGCAGTGG - Intronic
1086913189 11:92496648-92496670 TAATTCTGTCTCTAGGGCAGTGG + Intronic
1087395885 11:97597335-97597357 AAAATATGTTTGTAGGGCAGTGG - Intergenic
1087852277 11:103045781-103045803 TAAATATTTCTTTAGGGGAGAGG - Intergenic
1089146607 11:116333791-116333813 GAAATCTTTCTCTAGAGAAGAGG + Intergenic
1090751702 11:129751823-129751845 CAAAACTTTCTGCTGGGAAGAGG - Intergenic
1091042832 11:132297950-132297972 CAATACATTTTGTAGGGCAGGGG - Intronic
1091547205 12:1509446-1509468 CAAATGTTTCTTTAAGGCAGGGG - Intergenic
1094487230 12:30934758-30934780 TAAATTTTTATGTAGAGCAGGGG - Intronic
1094523416 12:31216247-31216269 CAAAGCATTCTGCAGTGCAGTGG - Intergenic
1095741008 12:45607282-45607304 CAAATTTTTTTGTAGGGACGAGG - Intergenic
1096526267 12:52212064-52212086 CAAGTCTTTCTGAGGGCCAGTGG - Intergenic
1097574280 12:61372095-61372117 CAAATGTTTCTGATGGGGAGGGG - Intergenic
1099240964 12:80138184-80138206 TAAATCTTTCCTTAGGGCAAAGG + Intergenic
1100173534 12:92004419-92004441 CAAATCTCTATAAAGGGCAGAGG - Intronic
1100855085 12:98750960-98750982 CAAACCTCTCTGGAGGCCAGGGG + Intronic
1101926795 12:108978554-108978576 CAAGTATTTCTGGGGGGCAGTGG - Intronic
1102530863 12:113545734-113545756 CAAATCTGTCTACAGGGTAGGGG + Intergenic
1108028713 13:46205957-46205979 CAGATGTTTCTGAAGGGCAGAGG + Intronic
1109988616 13:70023311-70023333 CAAATATTTGAGTAGGGAAGAGG - Intronic
1110883475 13:80602445-80602467 CAAATCTTACTGTAGGGATGGGG + Intergenic
1111657696 13:91174199-91174221 CAAATCAATCCCTAGGGCAGTGG + Intergenic
1112293570 13:98166470-98166492 CAAAGCTACCTGTAGGGGAGAGG + Intronic
1114919831 14:27312537-27312559 TAAATCTTTATGGGGGGCAGAGG - Intergenic
1118235304 14:63998045-63998067 AAAGTCTTTCCGTAGGACAGAGG - Intronic
1122537335 14:102474845-102474867 AAAATCTTTGTGTGGGGCAGGGG - Intronic
1122687539 14:103517140-103517162 CTTATATTTCTGTAGGGCAACGG + Intergenic
1125042943 15:35213205-35213227 CCAACCTTTCTTAAGGGCAGGGG + Intergenic
1125329392 15:38567041-38567063 AAAATCTTTGTGTGTGGCAGGGG + Intergenic
1129931264 15:79412776-79412798 CAAAGCATTTTGTAGGGCAGTGG - Intronic
1131279170 15:91006949-91006971 CATATCTTTCTCTTGGACAGAGG - Exonic
1131647795 15:94364106-94364128 CAAGTATTTCTGTAGTTCAGGGG + Intronic
1133639367 16:7701965-7701987 CAAATCTTTCTGTAGGGCAGAGG + Intronic
1135270008 16:21061009-21061031 TAAATTTTTCTGTAGAGCCGTGG + Intronic
1136005294 16:27325056-27325078 AAACTCTGTCTCTAGGGCAGTGG - Intronic
1136072484 16:27796269-27796291 CCTTTCTTTCTGGAGGGCAGAGG - Intronic
1136232069 16:28892342-28892364 CAAAACTCTGTGAAGGGCAGGGG - Intronic
1138902554 16:61291445-61291467 CAAAATTTTCTGAAGGACAGAGG + Intergenic
1141087246 16:81105013-81105035 CAAATCTTTTTGCAGGACAAAGG + Intergenic
1141272222 16:82551772-82551794 TAATTCTTTCTGTACCGCAGTGG + Intergenic
1143214118 17:5211348-5211370 TAAATTTTTCTGTAGGGACGAGG - Intronic
1143479149 17:7218733-7218755 CAAATCTTTCCGTAGGGGCTGGG - Intronic
1145865807 17:28240879-28240901 CAAAGGTTTCTCTAGGGCATAGG + Intergenic
1146323367 17:31864595-31864617 CAAATCTTTCTCTAATCCAGAGG + Intronic
1149394624 17:56227043-56227065 AAGATCTTTCTGTAGGTCTGAGG + Intronic
1149743768 17:59074381-59074403 CATATATATCTGTAGGGCATTGG - Intronic
1150660428 17:67071313-67071335 TATATCTTTCAGTAGGTCAGAGG - Exonic
1150921577 17:69489587-69489609 TAAATCTTTCTATAGGACTGTGG + Intronic
1152641048 17:81449412-81449434 CAAATCTTGCTGTCTGGCACAGG - Intronic
1152927896 17:83095954-83095976 CAGATCTTTCTCTAGGACATTGG + Intergenic
1154217959 18:12429330-12429352 GAAATCTTTCTGTGTTGCAGGGG + Exonic
1155844963 18:30694870-30694892 CAAAGCACTTTGTAGGGCAGCGG + Intergenic
1157282855 18:46357614-46357636 CATCTCTTTCTGTGGGGCACTGG + Intronic
1157485102 18:48081126-48081148 CAAATCTTTGAGAAGGGAAGTGG + Intronic
1158732506 18:60040130-60040152 AAAATCTTGCTGGAGTGCAGTGG + Intergenic
1161543637 19:4867160-4867182 CAAAACCATCTGTAGGGGAGGGG + Intronic
1162752602 19:12838255-12838277 CAAATCCTTCTGGAAGGCAAAGG - Intronic
1163427685 19:17248071-17248093 CAAATGTTACTGCAGGGCCGCGG - Intronic
1168614711 19:57828402-57828424 CAGATCTTTCTACTGGGCAGAGG - Intronic
926716922 2:15932081-15932103 GAAAGATATCTGTAGGGCAGTGG - Intergenic
929757270 2:44778258-44778280 CCAAGCTTTCTGAATGGCAGTGG + Intergenic
929965644 2:46533660-46533682 CATTTCTTTGTGTAGGTCAGTGG + Intronic
931170212 2:59795254-59795276 AAAATGTTTCTGTAGGGCTGAGG + Intergenic
931393402 2:61864320-61864342 CAAATCATTCTGAAGGGCCTGGG - Intergenic
932137032 2:69240380-69240402 CAAATATTTGTGGAGGGCATAGG + Intronic
932210189 2:69921381-69921403 CAAAGCTTTCTGTAGGCTAAGGG - Intronic
934474607 2:94586135-94586157 CAGATCTTTCTGCAGGGGTGAGG - Intergenic
935445078 2:103147653-103147675 CACATCTTTCTTTAAGGAAGGGG - Intergenic
935729959 2:106057097-106057119 CAATTCTTTCTTTAGGGCTGGGG + Intergenic
936780504 2:116027224-116027246 CAAATCTGTCTGTGGTGGAGTGG + Intergenic
937081904 2:119146323-119146345 CGATTCTTTCTGAAGGGCATTGG - Intergenic
937247791 2:120504628-120504650 CAAGTCTTTGTGTGGGACAGTGG - Intergenic
938271343 2:129974897-129974919 CAATTTTTTTTGAAGGGCAGAGG - Intergenic
940361527 2:152800989-152801011 CATATCTTTCTTTATAGCAGAGG - Intergenic
940456867 2:153912841-153912863 CAAAGCTCTTTGTAGGGCAGTGG + Intronic
941114250 2:161453078-161453100 TAAATCTTACTGAAGGACAGAGG - Intronic
941219870 2:162763993-162764015 AAAATCTTTCCTTAGGACAGAGG - Intronic
945785429 2:214229300-214229322 CTAATCTTTCAGTAGAGTAGGGG + Intronic
948035773 2:234857411-234857433 CAGCTCAATCTGTAGGGCAGAGG + Intergenic
1169680212 20:8203750-8203772 CAAATGTTTCTGGAGGGAAGAGG + Intronic
1170301838 20:14892716-14892738 CAATTCTTTCTGGAGTGCAATGG + Intronic
1172022703 20:31925584-31925606 CAAATCTTTTTGCTGGGCACAGG + Intronic
1172298781 20:33833197-33833219 CAGATCTTTCTGTGGGGCCATGG - Intronic
1173087772 20:39940720-39940742 CATATCTTTGTACAGGGCAGAGG - Intergenic
1173814162 20:45974343-45974365 CAGATGCTTCTGTAGGGCTGAGG - Intergenic
1176907010 21:14513690-14513712 CATATATTACTGTATGGCAGAGG - Intronic
1179063331 21:38000675-38000697 CAAAACTTTCTGGAAAGCAGGGG - Intronic
1183298499 22:37046349-37046371 CAAAGCCTTCCCTAGGGCAGAGG + Intergenic
1185127508 22:49019724-49019746 CAAAACTTTCTGTAAAGCAGTGG - Intergenic
951733302 3:25834752-25834774 CCAATCTTTCTATATAGCAGAGG + Intergenic
951804881 3:26633047-26633069 CAAGTCTTTTGGTGGGGCAGGGG - Intronic
955144790 3:56306266-56306288 CAAGTATTTCTTTAGGGCAGGGG - Intronic
955938974 3:64129916-64129938 CAAGTCTTTCTGATGGGAAGGGG - Intronic
956181696 3:66523577-66523599 TACATCTGGCTGTAGGGCAGCGG + Intergenic
957700028 3:83698167-83698189 CAAAAGTTTCTGTAGAGCAAAGG + Intergenic
960258039 3:115532755-115532777 CAAAGCATTTTGTAGGGCAGTGG + Intergenic
960262131 3:115580109-115580131 AAAATTTTTCTGTAGGGAAGGGG - Intergenic
960352615 3:116611665-116611687 CAAAGCTTGCTTTAGGGCAGGGG - Intronic
963690533 3:148495630-148495652 CAAATCTTTCTCTAGTGTAGTGG + Intergenic
963712826 3:148767150-148767172 AAAATCTTCCTGTAAGGCACAGG - Intergenic
967598924 3:191361218-191361240 AAAAACTTTCTGTAGGTCACGGG + Intronic
968351518 3:198058251-198058273 TGAATGTTTCTGTAGGGCTGGGG - Intergenic
970934565 4:21553954-21553976 CATATCTTTCAGTGGGGAAGGGG + Intronic
971444453 4:26728204-26728226 GAAATGTTTCTGCAGTGCAGTGG + Intronic
971802613 4:31312011-31312033 CAAATATTCCTGTAGGGCTTTGG - Intergenic
974151427 4:58015107-58015129 TAGATGTTTCTGTAGAGCAGAGG + Intergenic
974556317 4:63453458-63453480 CAGATCTTGCTGGAGTGCAGTGG + Intergenic
975361461 4:73476340-73476362 CAAAGCATTCTGTAGTGTAGTGG + Intergenic
975557064 4:75675312-75675334 CAGAACTTTCTCTAGAGCAGTGG + Intronic
976089542 4:81441921-81441943 CAAATGTTACTGTAGGGATGGGG + Intronic
977922716 4:102663148-102663170 AAAATATTTCTTTGGGGCAGGGG - Intronic
981907677 4:149941068-149941090 GAAATCTTTCTGAAAGGCAATGG - Intergenic
982767924 4:159369107-159369129 AAATTCTTCCTCTAGGGCAGCGG - Intergenic
983312105 4:166077803-166077825 AAAATCTTTCAACAGGGCAGTGG + Intronic
984731737 4:183074966-183074988 CAGATCACTCTGTAGGGCTGAGG - Intergenic
986881377 5:12175989-12176011 CAAATCATCCTATAAGGCAGCGG - Intergenic
986903779 5:12468544-12468566 CAAAACACTTTGTAGGGCAGTGG - Intergenic
987180718 5:15365231-15365253 AATATCTTCCTGTGGGGCAGAGG - Intergenic
988418750 5:30979203-30979225 CAAGTGTTTATATAGGGCAGTGG - Intergenic
991674596 5:69078360-69078382 CAAGTATTTCTCTAGGCCAGTGG + Intergenic
994086912 5:95768983-95769005 CAAGTATTTCTATGGGGCAGCGG - Intronic
994637761 5:102363945-102363967 AAAATCAATCTCTAGGGCAGGGG + Intergenic
994643008 5:102433692-102433714 CAAAGCACTTTGTAGGGCAGTGG + Intronic
994970569 5:106731335-106731357 CAAAACTCTTTGTAGGGCTGTGG - Intergenic
995012513 5:107273901-107273923 CAAACAATTCTGTGGGGCAGAGG + Intergenic
995070281 5:107913341-107913363 CAAGTCTTGGAGTAGGGCAGAGG + Intronic
996364854 5:122690274-122690296 CAAATCTTTCTTTAGGTTAGTGG - Intergenic
996816539 5:127580071-127580093 AAAAACTTTCTGCAGCGCAGAGG + Intergenic
998674218 5:144389187-144389209 GAAATCATCATGTAGGGCAGGGG + Intronic
1000735539 5:164894503-164894525 CAACTCTTTCTGAAAGGCGGTGG + Intergenic
1003378999 6:5605387-5605409 CAAAGCTTTCTATAGGCTAGAGG - Intronic
1004037599 6:11938853-11938875 CAACTCCCTCTGTAAGGCAGGGG + Intergenic
1007120391 6:39375912-39375934 CCAACCATTCTGGAGGGCAGAGG - Intronic
1008648612 6:53541867-53541889 CAAATCTTTTTTTGGGGTAGGGG + Intronic
1010938702 6:81890319-81890341 CAGATCTATCTCTAGAGCAGTGG + Intergenic
1011193365 6:84758112-84758134 GAAATCTTCCTTTAGGCCAGAGG + Intronic
1014055146 6:117005630-117005652 CTAATCTTTCTGTATGCAAGGGG + Intergenic
1016285437 6:142467836-142467858 CAAAACTTTGTGTAAGCCAGTGG - Intergenic
1016807097 6:148222546-148222568 CAAATCTTTCTGGAAGTCAGAGG - Intergenic
1020252427 7:6480256-6480278 CAAATTTTCCTGTAGGCCAATGG - Intronic
1020921517 7:14270819-14270841 GAAAGCTTTCTGTAGGGGGGTGG + Intronic
1022219678 7:28300743-28300765 CTCATCTTTCTGTAGGACAGTGG + Intronic
1022457635 7:30572896-30572918 TAAATCTTTCTGGGAGGCAGAGG + Intergenic
1024109895 7:46134410-46134432 CAAATCTTACAGTGGGGAAGCGG - Intergenic
1028160952 7:87484033-87484055 GAACTCATTCTTTAGGGCAGTGG - Intergenic
1028448374 7:90951340-90951362 CAAAGCTTTGTGTTGGTCAGTGG - Intronic
1029008405 7:97233276-97233298 CAAATGTTCATGTAGGCCAGAGG + Intergenic
1029628057 7:101732807-101732829 TAAATCTTTCTGTAGAGATGGGG + Intergenic
1034130923 7:148716811-148716833 CAAATCTATCAGTAGGGGACAGG - Intronic
1035224644 7:157426578-157426600 CGAACCTCTCTGTAGGGAAGGGG + Intergenic
1035420068 7:158720245-158720267 TAAATATTTCTGTCGGGGAGAGG - Intergenic
1036079901 8:5543532-5543554 CAAATCCTTCAGTAAAGCAGGGG + Intergenic
1037224528 8:16569088-16569110 TTAATCTTTCTTTAGGGCTGAGG - Intergenic
1037268114 8:17091067-17091089 CAGATTTTTGTGTAGAGCAGAGG - Intronic
1038202335 8:25424998-25425020 CAAATCACTCTTAAGGGCAGTGG + Intergenic
1038251465 8:25908884-25908906 CAAGACTTTCTGTACAGCAGGGG - Intronic
1038390345 8:27192556-27192578 CAAACATTTCAGTATGGCAGAGG - Intergenic
1039654736 8:39390669-39390691 CATGTCTCTCTGTAGGGGAGAGG + Intergenic
1042006270 8:64183298-64183320 CAAAGTGTTTTGTAGGGCAGTGG - Intergenic
1043534239 8:81183855-81183877 CAAATCTTTTTGAAGGTCTGGGG + Intergenic
1044044597 8:87415355-87415377 CAAAACATTCTGTGAGGCAGTGG - Intronic
1044877801 8:96689184-96689206 CAAATCATTCTGTGGAGCTGGGG + Intronic
1049529153 8:143145595-143145617 AAAATCTTTCTGTAGAGATGGGG - Intergenic
1049808457 8:144552000-144552022 CACACCTCTCTGTAGGGCAGGGG + Intronic
1052855447 9:33403623-33403645 CAGATCTTTCTGCAGGGGTGAGG + Intergenic
1052893264 9:33723083-33723105 CAAAACTTTCTGCTGGGAAGAGG - Intergenic
1053683461 9:40499966-40499988 CAGATCTTTCTGCAGGGGTGAGG + Intergenic
1053933440 9:43128281-43128303 CAGATCTTTCTGCAGGGGTGAGG + Intergenic
1054280254 9:63124962-63124984 CAGATCTTTCTGCAGGGGTGAGG - Intergenic
1054394582 9:64639969-64639991 CAGATCTTTCTGCAGGGGTGAGG + Intergenic
1054429231 9:65145168-65145190 CAGATCTTTCTGCAGGGGTGAGG + Intergenic
1054501153 9:65876367-65876389 CAGATCTTTCTGCAGGGGTGAGG - Intergenic
1055259995 9:74422909-74422931 CACATGTTTCTGTGGGGAAGAGG - Intergenic
1055359568 9:75475373-75475395 TAAATCTTTATGTGGGGCAGAGG + Intergenic
1055364350 9:75527256-75527278 AATACCCTTCTGTAGGGCAGTGG - Intergenic
1057856019 9:98601342-98601364 CAAATTTTTCTGTAGAGATGAGG - Intronic
1061747397 9:132750436-132750458 CACATCTTTCTGTCCGGCATCGG + Intronic
1187899921 X:24017928-24017950 AAAATTTTTTTGTAGGGAAGAGG - Intronic
1187959824 X:24557933-24557955 CACATCCTTCTGAAGGGCTGGGG + Intergenic
1188833924 X:34933291-34933313 CAAAGCACTTTGTAGGGCAGTGG - Intergenic
1188852769 X:35151497-35151519 CAAAGCTTTTCGTAGGGCAGTGG - Intergenic
1193494706 X:82196987-82197009 CAAGTGTTTTTGTAGGGCAGTGG + Intergenic
1193623399 X:83786039-83786061 AAATTCTTTGTGTTGGGCAGAGG - Intergenic
1194791145 X:98151453-98151475 AAAAAGTTTCTGTAGAGCAGAGG - Intergenic
1196802083 X:119552743-119552765 CATTCCTTTCTCTAGGGCAGAGG + Intronic
1197934630 X:131728015-131728037 TAAATCTTTATGTGAGGCAGAGG - Intergenic
1199758250 X:150884784-150884806 CAAAAGTTTCTCTAGGGCAGAGG - Intronic
1201710339 Y:16985028-16985050 GAAATCTTACTGTCGGGCGGAGG + Intergenic