ID: 1133639369

View in Genome Browser
Species Human (GRCh38)
Location 16:7701969-7701991
Sequence TCTTTCTGTAGGGCAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 332}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133639357_1133639369 30 Left 1133639357 16:7701916-7701938 CCTGTTGCAGCAAACCAGGGTGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1133639369 16:7701969-7701991 TCTTTCTGTAGGGCAGAGGTGGG 0: 1
1: 0
2: 2
3: 34
4: 332
1133639362_1133639369 3 Left 1133639362 16:7701943-7701965 CCTGAGGTTCTGGAAACCCTCTC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1133639369 16:7701969-7701991 TCTTTCTGTAGGGCAGAGGTGGG 0: 1
1: 0
2: 2
3: 34
4: 332
1133639360_1133639369 16 Left 1133639360 16:7701930-7701952 CCAGGGTGCATGGCCTGAGGTTC 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1133639369 16:7701969-7701991 TCTTTCTGTAGGGCAGAGGTGGG 0: 1
1: 0
2: 2
3: 34
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133639369 Original CRISPR TCTTTCTGTAGGGCAGAGGT GGG Intronic
900976380 1:6019386-6019408 CCTTGCTGTAGGACAGGGGTTGG - Intronic
901338193 1:8470192-8470214 TCTTTGTGTAGGGGTGAGGACGG - Intronic
901501921 1:9657758-9657780 TTCATCTGTTGGGCAGAGGTGGG + Intronic
902406658 1:16187812-16187834 TGTGTCTGTGGGGCAGGGGTAGG - Intergenic
903019791 1:20386060-20386082 TGTTTCTGGAGGGCAGAAGGTGG - Intergenic
903405304 1:23090773-23090795 CCTTTCTGTAGGGCACAGTGAGG - Intronic
903777770 1:25804243-25804265 TCATTCAGTAGGTCTGAGGTGGG + Intronic
905082599 1:35337528-35337550 TAGGTCTCTAGGGCAGAGGTTGG + Intronic
905576690 1:39050229-39050251 TCTTACTGCTGGGCAGGGGTGGG - Intergenic
906992403 1:50753183-50753205 TGGTTCTCTAGGGAAGAGGTTGG - Intronic
907265021 1:53253621-53253643 TCTTTCTATAGGGCAAAGGATGG + Intronic
910170473 1:84371794-84371816 TGATTCTGTAGGACTGAGGTGGG - Intronic
911660058 1:100491277-100491299 TCTTTTTGTAAGGAAGAAGTAGG + Intronic
915129612 1:153687616-153687638 CTTTTCTGTGGGTCAGAGGTCGG - Exonic
917138061 1:171806809-171806831 TCTTTCTTTCAGGCAGAGATTGG + Intronic
918011972 1:180595283-180595305 TCTTTCTATAAAGCAGAGTTTGG + Intergenic
919034226 1:192284944-192284966 GCTTTCTGGAGGGCAGATGCAGG + Intergenic
919438762 1:197600006-197600028 TTTTCCTGTGGGGAAGAGGTTGG - Intronic
919944978 1:202312354-202312376 TCTTTCTGGAGAGCAGGGGTGGG + Intronic
920575910 1:207060108-207060130 TCTTGCTGCAGAGGAGAGGTGGG - Intronic
920783398 1:209016712-209016734 TCTTTCTGTAAGAAAGAGCTGGG + Intergenic
921601912 1:217115005-217115027 GCTTTGTGTAGGGAAGAGGGCGG + Intronic
922314206 1:224427452-224427474 TTTTTCTATGGGGCAGAGGTGGG + Intronic
922748065 1:228058367-228058389 TCTTTCTTTGGGGAAGGGGTAGG - Intronic
922804072 1:228376824-228376846 TCTTTGTGCTGGGCAGGGGTTGG - Exonic
923467786 1:234264746-234264768 TCTTTCTGTGTTGCACAGGTTGG + Intronic
1063037274 10:2298801-2298823 TCTTCCTGTAGGGCAAAGCTTGG + Intergenic
1064034196 10:11902024-11902046 TGTTTCTGAAGGGCATACGTAGG + Intergenic
1064275173 10:13898934-13898956 GCTCTCTGGAGGGCCGAGGTGGG + Intronic
1066448916 10:35510410-35510432 TCTTGCTGTATGGCTCAGGTTGG + Intronic
1067292812 10:44956742-44956764 TATTTCTTCAAGGCAGAGGTTGG - Intergenic
1068944826 10:62719264-62719286 TCTTTGTGTAGACAAGAGGTGGG - Intergenic
1069845804 10:71370371-71370393 TCTTGCTGAGGGGCAGAGGTTGG - Intergenic
1070198903 10:74184439-74184461 CCTCTCTGGAGGGCTGAGGTGGG - Intronic
1070686482 10:78487587-78487609 TTATTCTTTAGGGCAGAGGCTGG - Intergenic
1071242046 10:83717911-83717933 TCTTTCTGAAGGGCCTAGGTGGG - Intergenic
1071721340 10:88149591-88149613 CCTTTCTGCAAGGCAGAGGAGGG + Intergenic
1072137950 10:92564859-92564881 TCTTACTGTGTTGCAGAGGTTGG - Intronic
1072545441 10:96433249-96433271 TCTTTGGGTGGGGCTGAGGTTGG + Intronic
1073431105 10:103487822-103487844 TTTGTCTGTGGGGCAGAGGAAGG + Intergenic
1075407724 10:122205674-122205696 TCCTTCTGCAGGGCTGGGGTGGG - Intronic
1076410187 10:130243838-130243860 TCCAGCTGTTGGGCAGAGGTTGG + Intergenic
1078480406 11:11670741-11670763 TATTTTTGAAGGCCAGAGGTGGG + Intergenic
1078544575 11:12237799-12237821 GCTTTCTGTAGGTCTGGGGTGGG - Intronic
1079296781 11:19241508-19241530 TCTTTCCGCAGCGCCGAGGTGGG + Exonic
1080941875 11:36927504-36927526 TCCTTCTGTAAGGTGGAGGTGGG - Intergenic
1081553236 11:44133336-44133358 TCTTTAGGGAGGTCAGAGGTGGG + Intronic
1081607601 11:44537094-44537116 TCTGTCTGAGGGTCAGAGGTGGG + Intergenic
1081826906 11:46063566-46063588 TGATTCTGTAGGGCAGGGATTGG - Intronic
1083143472 11:60740255-60740277 TCTTTCTCTGGAGCAGAGGGTGG - Intronic
1083697321 11:64451561-64451583 ACTTTCTGCAGGGCAGATGTGGG + Exonic
1083933863 11:65860389-65860411 TCTTTGTGTAGGCGAGAGGAAGG - Exonic
1083997632 11:66279928-66279950 TCTTTCTGTGGGGTAGGGGCAGG + Intronic
1084322315 11:68380467-68380489 TCTAGCTGTCGGACAGAGGTCGG - Intronic
1084922069 11:72479327-72479349 CCTTTCTGCATAGCAGAGGTTGG - Intergenic
1085457855 11:76675390-76675412 TGGTTCAGTAGGTCAGAGGTGGG + Intergenic
1086095877 11:83049443-83049465 TTTTTCTGGGGGGCAGAGGCGGG + Intronic
1086913191 11:92496652-92496674 TCTGTCTCTAGGGCAGTGGTGGG + Intronic
1087499072 11:98928713-98928735 TCCTTCTGTAGGAGAGAGCTGGG - Intergenic
1088121748 11:106378296-106378318 TCTCTCTGTAGGTCTGAGCTGGG + Intergenic
1088397417 11:109383654-109383676 TCATTCTGTCAGTCAGAGGTAGG - Intergenic
1088518100 11:110660346-110660368 TCTTTCTGTAGGCCAGTGACTGG - Intronic
1088684639 11:112274506-112274528 TGGATCTGTAGGTCAGAGGTGGG + Intergenic
1088851265 11:113705403-113705425 TCTTTCTATAGGCAAGATGTTGG - Intronic
1089214823 11:116829249-116829271 CCTTAGTGTAGGGCAGGGGTTGG - Intergenic
1090183803 11:124722895-124722917 TCTATCTTTAGGGCAGAGAAAGG - Intergenic
1091349886 11:134884974-134884996 TCTTTTTGTACAGCAGAGATTGG - Intergenic
1091547204 12:1509442-1509464 TGTTTCTTTAAGGCAGGGGTTGG - Intergenic
1091708098 12:2713800-2713822 TCTATCTCTAGGGCCGAGGGGGG - Intergenic
1092007524 12:5082029-5082051 TATCTCTGGAGGGCAGAGGAGGG + Intergenic
1093323385 12:17741930-17741952 TCTTTTTCTGGGGCAAAGGTTGG + Intergenic
1093507387 12:19884240-19884262 TGTCTCTGTAGGGCAGAATTTGG + Intergenic
1094780153 12:33781889-33781911 TTTTTATGCAGGTCAGAGGTTGG - Intergenic
1095133656 12:38572099-38572121 TGATTCTGGAGGGCAGAGGCAGG + Intergenic
1096168470 12:49446338-49446360 AGTTTCTGTAGGTCAGATGTTGG + Intronic
1097144185 12:56928773-56928795 TGTTTTTGGAGGGTAGAGGTGGG - Intronic
1097189301 12:57211909-57211931 TATATCTGGAGGGAAGAGGTGGG - Exonic
1097743606 12:63273987-63274009 TCTTTCTGTAATGTAGAAGTTGG - Intergenic
1097748191 12:63323093-63323115 TCTTTCTTTAGGACAAAGATTGG + Intergenic
1098640637 12:72834987-72835009 ACTTTCTGTAAGTCAGAAGTAGG + Intergenic
1098854501 12:75637083-75637105 CCTTTCTGTAGGGTCTAGGTAGG + Intergenic
1098959941 12:76729315-76729337 GCTTTCTGTAGGGCAGAGACAGG + Intergenic
1100169309 12:91955828-91955850 TCTCTTTTGAGGGCAGAGGTGGG + Intergenic
1103335121 12:120183673-120183695 TCTTACTGCAGAGCAGAGTTGGG + Exonic
1103607525 12:122098257-122098279 TCTCTCTGTGGGGAAGAAGTGGG - Intronic
1103970966 12:124671206-124671228 TCTTCCTGTGGGTCAGAGGTGGG - Intergenic
1105524447 13:21163280-21163302 TCCCTCTGTAGGGCAGAGATGGG - Intronic
1105764052 13:23540750-23540772 TATTTCTGGAGGGCAGGTGTGGG - Intergenic
1106287311 13:28329092-28329114 TCTTTCCGTATGGCAGGGTTAGG - Intronic
1106706445 13:32285339-32285361 TCTTTTTGTAGGCCACAGGCTGG - Intronic
1106813698 13:33384780-33384802 TCTTTTTTGAGGGTAGAGGTGGG - Intergenic
1108399734 13:50027776-50027798 TCTTTTTGAAGGGCCGAGCTGGG + Intergenic
1108675525 13:52734538-52734560 CCTTTCTGTGTGGCAGAGCTAGG + Intronic
1112480104 13:99767317-99767339 TTTTTCTGTTGGGGAGGGGTGGG + Intronic
1112627847 13:101126457-101126479 TCTTTCAGGAGGGGAGAAGTAGG - Intronic
1112678552 13:101734132-101734154 TGATTCTGTAGGTCTGAGGTGGG - Intronic
1112877079 13:104055958-104055980 TTTTTCTTTTTGGCAGAGGTTGG + Intergenic
1113440973 13:110327579-110327601 TCTTTCTATAGTGAAGAGATTGG + Intronic
1115092713 14:29597691-29597713 TCTTTCCGGAGGTCAGTGGTGGG - Exonic
1115429548 14:33300717-33300739 TCCTTTTGTAGGGGAGGGGTTGG + Intronic
1116981929 14:51180768-51180790 ACTTTCGGTAGGTCTGAGGTGGG - Intergenic
1117426135 14:55599543-55599565 TGCTTCTGTGCGGCAGAGGTTGG - Intronic
1117649315 14:57886481-57886503 TCTTAATGTAAGTCAGAGGTAGG + Intronic
1119202161 14:72764178-72764200 TCTTCCTGGAGGTCAGAGGTGGG - Intronic
1119690489 14:76668128-76668150 TTTTTCAGTAGGGTAGAGTTGGG - Intergenic
1119903594 14:78282202-78282224 GCTGCTTGTAGGGCAGAGGTGGG + Intronic
1119915613 14:78398528-78398550 TGTTACTGTTGGGCAGAGTTTGG + Intronic
1120108453 14:80523835-80523857 TCTTCCTCTAGACCAGAGGTTGG + Intronic
1120887045 14:89459920-89459942 TCTTGCTGTAGGGCTGACCTTGG - Intronic
1121092600 14:91193192-91193214 TGTTTCCGTAGGGCAGAGAAAGG + Intronic
1122377810 14:101277944-101277966 CCTTACTGTTGGGCAGGGGTAGG - Intergenic
1126588311 15:50312596-50312618 TACTTCTGTAGGAGAGAGGTCGG - Intronic
1126606961 15:50487624-50487646 GCTTCCTGAAGGGCAGAGATGGG - Intronic
1128061847 15:64740437-64740459 TCTATCTGTTGGGTGGAGGTGGG + Exonic
1129044511 15:72721984-72722006 TCTTTCTGTAGATCAAAGGTTGG + Intronic
1129951167 15:79592777-79592799 TCTATCTGTAGGGCAGGAGTAGG + Intergenic
1130017115 15:80196118-80196140 TCATTCTGTAAGCCTGAGGTGGG + Intergenic
1131248791 15:90817733-90817755 TCCTTCTGGAGGGCACAGGCAGG + Intergenic
1131387687 15:92020654-92020676 TCTCTCTGTAGGGGAGTGCTGGG - Intronic
1131476329 15:92743430-92743452 TTTTTTTGGAGGGGAGAGGTAGG - Intronic
1132015068 15:98308161-98308183 TTGTTCTGTAGAGCAGAGATTGG - Intergenic
1132024298 15:98391947-98391969 CCTTCCTGTAGAGCAGACGTGGG - Intergenic
1132220701 15:100103015-100103037 TCTTTCTGGATGACAGAAGTGGG - Intronic
1133149410 16:3816381-3816403 TCTTTCTTGGGGGCAGTGGTTGG - Intronic
1133639369 16:7701969-7701991 TCTTTCTGTAGGGCAGAGGTGGG + Intronic
1134014486 16:10878881-10878903 TCTTTCTGCAGCGCTGAGCTCGG - Intronic
1135904510 16:26498925-26498947 TCTGTCTGGAGTGCAGTGGTTGG + Intergenic
1137065553 16:35838434-35838456 TTTTTCTGAAAGGCAGAGGCAGG + Intergenic
1138513788 16:57524613-57524635 TCTTGCTGTATGGCCCAGGTTGG + Intronic
1139975535 16:70806996-70807018 TTTCTGTGTAGGGCAGATGTGGG + Intergenic
1140001441 16:71029102-71029124 TATTTCTTTAGAGCAGATGTTGG + Intronic
1140043370 16:71424277-71424299 TCTTTCTTAGGGGCAGAGGCTGG - Intergenic
1140993839 16:80241676-80241698 TCTTTCTGGGAGGCTGAGGTGGG + Intergenic
1143547484 17:7606574-7606596 TCTTGCTGTATTGCGGAGGTAGG - Intronic
1146895788 17:36540955-36540977 ACTTTCTGAAGGGCATAGATAGG - Intronic
1147994389 17:44353181-44353203 TCTTTCTGTGGGGTAGGGGAGGG - Intergenic
1148325393 17:46780375-46780397 TCTGTATGTAGGGGAGAGGAGGG - Intronic
1148512274 17:48181679-48181701 CCTTTCTGCAGAACAGAGGTAGG + Intronic
1149170567 17:53805563-53805585 TCTTTATACAGGGCAGAAGTAGG - Intergenic
1149494522 17:57108848-57108870 CCATTCTGTGGGGCAGAGGCTGG + Intronic
1150218625 17:63483751-63483773 GCTTCCTGCAGGGCAGAGGCTGG - Intergenic
1150330730 17:64292352-64292374 TATTTCTGTAGTGTAGAGATAGG + Intergenic
1151478873 17:74358510-74358532 TCTTTCTGTATTGCTCAGGTTGG + Intronic
1152812516 17:82388754-82388776 GCTTTCTGCAGGGCCGAGGCCGG - Intergenic
1153375914 18:4378921-4378943 TCTCTCTGGAGGGGAGTGGTGGG - Intronic
1154217961 18:12429334-12429356 TCTTTCTGTGTTGCAGGGGTGGG + Exonic
1155408268 18:25513626-25513648 TCTTTCTGTGGGGCAGGAGCTGG - Intergenic
1155899948 18:31376825-31376847 TCTTTCTGTAGAGCAGAATTCGG + Intronic
1156290084 18:35740518-35740540 TCTTTCAGAAGGGGAGAGGGAGG - Intergenic
1156817902 18:41334010-41334032 GCTTTCTGTAGGGCAACTGTTGG + Intergenic
1157874216 18:51256994-51257016 TCTTTTTTTGGGGCAGGGGTTGG + Intergenic
1159529551 18:69638074-69638096 TGTTTCTTTAGAGCAGAAGTTGG + Intronic
1159714837 18:71808715-71808737 TCTATCTGTAGGCCAAAAGTCGG + Intergenic
1161686853 19:5707189-5707211 TGTGTGTGTAGGGCCGAGGTTGG + Intronic
1164912432 19:32023675-32023697 CCTTTGTGCTGGGCAGAGGTGGG + Intergenic
1165354734 19:35296424-35296446 GCTTTCTGTTGGCCAGAGCTGGG - Intronic
1166343691 19:42152643-42152665 TCCTGCTGTAGGGGAGTGGTGGG - Intronic
1166719595 19:44989504-44989526 TCATTCTGATGGGCAGGGGTGGG + Intronic
1166806785 19:45492492-45492514 CCTTTCTGGAGTGCAGTGGTGGG - Intronic
1168012805 19:53546931-53546953 TCTGGATCTAGGGCAGAGGTTGG + Intronic
1168721975 19:58559140-58559162 TCTTTGAGTGGGGCAGACGTGGG + Intergenic
926580731 2:14631566-14631588 TCGCTTTGTAGGGAAGAGGTGGG + Intergenic
927200855 2:20577312-20577334 TCTTTCTGAAGGGCTGGGTTTGG - Intronic
928319763 2:30273823-30273845 TGTTTCCGTGGGGCAGGGGTCGG - Intronic
928672193 2:33613039-33613061 TCTTTCTGTAATGGAGAGGAGGG + Intergenic
930202744 2:48560549-48560571 TCCTTCTGAAGGCCAGGGGTGGG + Intronic
930394744 2:50807220-50807242 ACTTTCTTCAAGGCAGAGGTAGG - Intronic
931114785 2:59152845-59152867 GGTTTCTGAAGAGCAGAGGTGGG - Intergenic
931256267 2:60576541-60576563 TCTGGCTTTAGGGCAGCGGTTGG + Intergenic
931662842 2:64584532-64584554 TCTTTCTTCAGGTTAGAGGTGGG - Intronic
931835309 2:66092827-66092849 TCATTCAGTAGGTCAGAGGTAGG + Intergenic
932445492 2:71778386-71778408 TCTTTCTGGAAGGCAGAAGCAGG - Intergenic
932846603 2:75141870-75141892 TCTCACAGTAGGGCAGATGTGGG - Intronic
932972156 2:76557083-76557105 TCTTTATAAATGGCAGAGGTAGG - Intergenic
933091794 2:78129024-78129046 TTTTTCTTTAGGGCACATGTAGG + Intergenic
934136658 2:89002151-89002173 TCTGTCTGAATGGCACAGGTAGG - Intergenic
934474606 2:94586131-94586153 TCTTTCTGCAGGGGTGAGGCAGG - Intergenic
934938163 2:98480181-98480203 TGTTTCTGTAGGGCATTGGGTGG + Intronic
935242335 2:101189651-101189673 CCTTCCTGGAGGGCAGGGGTAGG - Intronic
936276309 2:111100776-111100798 CCTTTCAGTAGGGCAGACGAAGG - Intronic
936518162 2:113195649-113195671 TCTCTTTGTCTGGCAGAGGTAGG - Intronic
936950140 2:117969430-117969452 TGTTTCTGTGGGGCAGCAGTTGG - Intronic
937335869 2:121062114-121062136 TCTTTCTGGAGGTCAGAGGGAGG + Intergenic
937595036 2:123662029-123662051 TCTTTCTGGAGGGGAGAATTTGG - Intergenic
938610453 2:132942356-132942378 TGATTCTGTGGGGCTGAGGTTGG + Intronic
938831512 2:135054201-135054223 TGATTCTGTAGGTCTGAGGTGGG + Intronic
940081007 2:149801165-149801187 GCTTTTTGTAGGGAAGAGCTGGG + Intergenic
940337219 2:152542052-152542074 TCTGAATGTAGGTCAGAGGTGGG - Intronic
940414791 2:153407193-153407215 TGTTTCTGGAGGGCTGGGGTAGG - Intergenic
942059410 2:172214317-172214339 TGTTTCAGTAGGGCTGAGGTAGG + Intergenic
942457922 2:176150739-176150761 TGTTCCTGGAGGGCAGAGCTGGG - Intergenic
942994086 2:182239687-182239709 TCTGTCTTTAGGGCAGAGGAAGG + Intronic
943184179 2:184585292-184585314 GTTTACTGCAGGGCAGAGGTTGG - Intergenic
943315998 2:186388112-186388134 TCTTTCTGTATTACAGAAGTTGG + Intergenic
944802399 2:203248955-203248977 GCATTTTGGAGGGCAGAGGTGGG - Intronic
945773670 2:214078091-214078113 TCTTTCTGCAAGGGAGAGGAAGG + Intronic
946356440 2:219188537-219188559 TGTGTGTGTAGAGCAGAGGTGGG - Intergenic
946549851 2:220789281-220789303 TCTTTCAGTAGGGCATAGGTTGG - Intergenic
947560594 2:231146909-231146931 TGTTTCTGTGGAGCAGATGTGGG - Intronic
1168908542 20:1426511-1426533 GATTTCTGGAGGCCAGAGGTAGG + Intergenic
1171342647 20:24442881-24442903 CATTTCTGTTGGTCAGAGGTTGG + Intergenic
1172556417 20:35845805-35845827 TCTTACTGTATGGCCGAGGCTGG + Intronic
1173947370 20:46962517-46962539 TCTTTCTCCAGGGCTGAGGCAGG - Intronic
1174186917 20:48712618-48712640 TCTTGCTCTAGGTCAGTGGTAGG + Intronic
1174687464 20:52469354-52469376 TCTCCCTCTAGGGCAAAGGTGGG - Intergenic
1174760360 20:53201255-53201277 TCTTTCTGGAAGCCAGAAGTTGG + Intronic
1174875022 20:54217922-54217944 TCTTTCAGGTGGGCTGAGGTAGG + Intronic
1175634642 20:60570154-60570176 TCTTTCTCAAAGGCAAAGGTTGG + Intergenic
1175690426 20:61061709-61061731 TCTACTTGTAGGGCAGAGGGAGG - Intergenic
1177843895 21:26266144-26266166 TCATTGTGTAAGGCAGAGATTGG + Intergenic
1178082198 21:29077290-29077312 TCTTCCTGCAGGGCAGGGCTAGG - Intergenic
1178389989 21:32190314-32190336 TTTCTCTGTAGAACAGAGGTGGG - Intergenic
1178701772 21:34840019-34840041 CCTATCTGCAGGGCAGAGTTTGG - Intronic
1178921651 21:36742906-36742928 TGGTTCTTTAGGGCAGAGATGGG + Intronic
1179190999 21:39121596-39121618 TCGTTGTGGTGGGCAGAGGTGGG - Intergenic
1182007261 22:26971157-26971179 TCATTCTCTAGGGCAGGGATTGG + Intergenic
1182143110 22:27979645-27979667 TCTTTGTGTAGATCAGGGGTTGG - Exonic
1182298341 22:29323852-29323874 GCTTTCTGTAGGAATGAGGTAGG - Intergenic
1184089547 22:42285036-42285058 TCTCACTGGAGGGCAGAGGCTGG - Intronic
1184343471 22:43898923-43898945 TTTTTTTGTAGGGCAGGGGATGG + Intergenic
949338057 3:2998390-2998412 TGGTTCTGCAGGTCAGAGGTAGG - Intronic
949476512 3:4451725-4451747 TCTTCCTGGAGGGCAGTGGCCGG + Intronic
950025273 3:9815886-9815908 TCTTCCTCCAGGGCACAGGTGGG - Intronic
951353716 3:21638368-21638390 TCTTTCTCTGAGGCAAAGGTTGG + Intronic
953005022 3:38970113-38970135 TGTTTCTGTAGGGGAGAGAGCGG + Intergenic
953060795 3:39427369-39427391 ACTTTCTGTAGGAGGGAGGTGGG + Intergenic
953834718 3:46332595-46332617 TATCTCTTGAGGGCAGAGGTGGG + Intergenic
954633365 3:52058550-52058572 TCTTTCTCTAGGGCAGAGACTGG + Intergenic
954766528 3:52922735-52922757 ACCTTCTGTAGGGGAGAGGAAGG - Intronic
956020410 3:64927779-64927801 TTTTCCTGCAGGGCAGAGGATGG - Intergenic
956527364 3:70179592-70179614 AGTTTCTTTATGGCAGAGGTGGG + Intergenic
956780633 3:72600360-72600382 TCCATGTGTAGGGCAGTGGTTGG - Intergenic
957386307 3:79501263-79501285 AAATTCTGTAGGGCAGAGGTAGG - Intronic
958489989 3:94760493-94760515 TCTCTCTACAGGGCAAAGGTTGG + Intergenic
959058163 3:101589130-101589152 TCTTACTGTAAGGAAGAGCTTGG + Intronic
961502859 3:127350107-127350129 TCTTTCTGCGGCTCAGAGGTGGG - Intergenic
962101553 3:132347937-132347959 TCTTGCTCTAGGCCAGAGGTTGG + Intronic
964186717 3:153954287-153954309 TCTGTCTGCAGGGAAGAGGCTGG + Intergenic
964595288 3:158420239-158420261 TCTAACTGGAGGGCAGAGTTCGG - Intronic
966805226 3:183802374-183802396 TCTTTCTGTAGGGTAAAGTTTGG + Intronic
966874793 3:184315560-184315582 TGTTTCAGTAGGTCAGGGGTTGG + Exonic
966919772 3:184604039-184604061 TCTTTCTGAGAGGCAGAGGTCGG + Intronic
967875622 3:194266587-194266609 TCTTCCTTTAAGGGAGAGGTTGG + Intergenic
968351517 3:198058247-198058269 TGTTTCTGTAGGGCTGGGGCTGG - Intergenic
969301553 4:6300229-6300251 CCTTGCTGTAGTGCAGAGCTGGG + Intronic
970323759 4:14901629-14901651 GCTGTCTGTGGGGCAGGGGTTGG + Intergenic
971092083 4:23357387-23357409 TCATTCTATAGTCCAGAGGTTGG - Intergenic
971321878 4:25612289-25612311 TCTTTCTCCACGGCAGAGGCTGG - Intergenic
971375127 4:26050192-26050214 TCTTTCTCTGCGGCAGAGGAGGG - Intergenic
972022762 4:34335772-34335794 CCTTCCTGTGGGGCAGAGCTCGG - Intergenic
972587787 4:40454220-40454242 TCTGACTTTAGAGCAGAGGTTGG - Intronic
974421832 4:61685600-61685622 TCTTGAGGTAGGGAAGAGGTTGG + Intronic
975327235 4:73072274-73072296 TCTTTGTGTAGGGCAGAAAAAGG - Intergenic
977576604 4:98681552-98681574 TCTGTCTGGAGGGCAGAAGTCGG - Intergenic
978525982 4:109665801-109665823 TCTTTCTTTTTGGCAGGGGTGGG + Intronic
978924592 4:114227596-114227618 TGTTTCAGTAGGTCTGAGGTGGG + Intergenic
979014404 4:115414656-115414678 TTTTTTTGTAAGGCAGAGATAGG + Intergenic
980233341 4:130072016-130072038 TCTTACTGCAGTGCAAAGGTTGG - Intergenic
981700017 4:147597998-147598020 AGTTTCTGTAGGTCAGATGTTGG - Intergenic
982651992 4:158098145-158098167 TCTTCCTCTAGGGCTGAGATAGG + Intergenic
983230637 4:165126068-165126090 CCTTCCTGTGGGGCAGAGCTCGG - Intronic
984759482 4:183351360-183351382 TCTTTTTGTAGAGACGAGGTCGG + Intergenic
984885901 4:184449154-184449176 TCTGGCTGTAGGGCAGAGCTGGG - Intronic
985084634 4:186299692-186299714 GCTTTCTGGAGGGCAGCTGTGGG - Intergenic
985145880 4:186894047-186894069 GCTTTCTGTGGGGCAGACATTGG + Intergenic
986024401 5:3837002-3837024 TCCTTCTGTAGGGCATATCTGGG + Intergenic
989540648 5:42614434-42614456 TGATTCTGAAGGTCAGAGGTGGG + Intronic
990338287 5:54796376-54796398 TCTTCCTTGAGGGCAGAGGTGGG + Intergenic
990739073 5:58893940-58893962 TCTGTTTGCAGGGAAGAGGTAGG - Intergenic
990779187 5:59339093-59339115 TTTTTGTGTAGGACAAAGGTAGG - Intronic
992037118 5:72790925-72790947 TTTTTCTTTATGGTAGAGGTGGG - Intergenic
992094949 5:73354159-73354181 TGTTTTTGTAGGGGAGAGTTGGG - Intergenic
994099567 5:95878519-95878541 TCTTCCTGGAGGCCAGAGGCTGG - Intergenic
997582935 5:135028575-135028597 TCTTTTTGGAGGGCAGAGTGGGG + Exonic
998081666 5:139280320-139280342 TCATTCTCCAGGACAGAGGTTGG - Intronic
999026709 5:148241688-148241710 TATTTCATTAGGGCATAGGTGGG + Intergenic
1000041324 5:157487269-157487291 CTTTTATGTGGGGCAGAGGTAGG - Intronic
1000529891 5:162406505-162406527 TCTTTCTTTAGGGTAAAAGTTGG + Intergenic
1001012273 5:168109170-168109192 TGTTTCTTTAGGTCAGGGGTGGG - Intronic
1002380499 5:178824814-178824836 TCTTGCTGTGTGGCAGAGGCTGG - Intergenic
1003295432 6:4822160-4822182 TCTTTCTGTAGAGATGGGGTTGG + Intronic
1003689427 6:8338018-8338040 TCTTTGTGGAGGGCTGAGCTGGG - Intergenic
1004171466 6:13298789-13298811 TCTGTCTGTAGGTCTGGGGTGGG - Intronic
1004626480 6:17381824-17381846 TCTTTTTGGAGGGTGGAGGTGGG + Intergenic
1006424517 6:33955901-33955923 CTTTTCTGGGGGGCAGAGGTGGG + Intergenic
1007476244 6:42121857-42121879 TCTTGCTCTAGGGCAGGGGTGGG - Intronic
1007842522 6:44728387-44728409 TCTTTCCGGAGGGCAGGGCTAGG - Intergenic
1008839986 6:55891002-55891024 TCCTACTGGAGGGCAGCGGTGGG + Intergenic
1009461303 6:63917227-63917249 TCTTTCTGAAGGTCAGTTGTTGG + Intronic
1010256235 6:73761407-73761429 TCTTTCAGATGGTCAGAGGTTGG + Intronic
1012138529 6:95590884-95590906 CATTGCTGTAGGCCAGAGGTTGG + Intronic
1013192516 6:107815654-107815676 TCTTTCTGTTGCCCAGAGGCGGG + Intronic
1013242614 6:108260586-108260608 TCTTCCTGTAGGGCTGGTGTGGG - Intronic
1013331374 6:109104692-109104714 GCTACTTGTAGGGCAGAGGTGGG - Intronic
1013548849 6:111187473-111187495 TTTTTTTGTAGGGCAGGGGGAGG - Intronic
1015624271 6:135164027-135164049 TCATTCTGTAAGGCAGAATTAGG + Intergenic
1017235092 6:152110855-152110877 TCTTTCTGGTGGGCAGCCGTTGG + Intronic
1017241294 6:152171925-152171947 TCTTGCTATAGGGCAGAGGTTGG - Intronic
1021106177 7:16642485-16642507 TCTTTCTGGAGAGCAGTGGCTGG + Intronic
1021536177 7:21707240-21707262 TATTTCAGTAGGTCTGAGGTGGG - Intronic
1024048724 7:45602960-45602982 TCTTGCTGGAGGGCAGGTGTGGG - Intronic
1024244335 7:47457802-47457824 CCTGTCTGTAGGGCAGAGCTAGG - Intronic
1026830107 7:73605479-73605501 TGAGTCTGGAGGGCAGAGGTTGG + Intronic
1027753060 7:82176146-82176168 TTTTTCTGAAGGGCAGAGAAGGG + Intronic
1028219242 7:88176217-88176239 TGTTTCTGGAAGGCTGAGGTGGG - Intronic
1029525212 7:101089668-101089690 TTTTCCTGAAGGGCAGGGGTTGG + Exonic
1029626040 7:101720755-101720777 TCTTTCTGCAGGGCAGGAATTGG - Intergenic
1029628059 7:101732811-101732833 TCTTTCTGTAGAGATGGGGTGGG + Intergenic
1032176428 7:129631852-129631874 TCTTTGTGTAAGGCATAGATTGG + Intronic
1032575140 7:133045535-133045557 TTTATCTTTAGGGGAGAGGTAGG + Intronic
1033042299 7:137929363-137929385 TCGTTGTGAAGGGCAGGGGTGGG + Intronic
1034964559 7:155383156-155383178 TCTTCCTGCAGGGTAGAGGCTGG - Intronic
1035104198 7:156428611-156428633 TCATTCTGCAGAGCAAAGGTAGG + Intergenic
1035708432 8:1695199-1695221 TCTTTCTGTAGGGCCGGGCACGG - Intronic
1035708450 8:1695264-1695286 TCTTTCTGTAGGGCCGGGCATGG - Intronic
1035708469 8:1695328-1695350 TCTTTCTGTAGGGCCGGGCATGG - Intronic
1035708479 8:1695361-1695383 TCTTTCTGTAGGGCCGGGCATGG - Intronic
1035708489 8:1695394-1695416 TCTTTCTGTAGGGCCGGGTAAGG - Intronic
1035708525 8:1695524-1695546 TCTTTCTGTAGGGCCGGGCATGG - Intronic
1035708533 8:1695557-1695579 TCTTTCTGTAGGGCCGGGCATGG - Intronic
1035708543 8:1695590-1695612 TCTTTCTGTAGGGCCGGGCAAGG - Intronic
1036767146 8:11556345-11556367 TCATTATGTAGGGGAGGGGTGGG + Intronic
1037359155 8:18054552-18054574 TCTACCTGTAGGGCAAAGGTTGG - Intergenic
1040893688 8:52343170-52343192 TCTTTAGCCAGGGCAGAGGTGGG + Intronic
1042865951 8:73356849-73356871 TTATTCTGGAAGGCAGAGGTTGG - Intergenic
1043431923 8:80203742-80203764 TCCTTTTGCAGGGCAGGGGTTGG - Intronic
1044749717 8:95404474-95404496 TTTTTATGTAGGGCTGAAGTTGG - Intergenic
1045210398 8:100091983-100092005 TCTCTCTGTTGGGCATAGCTAGG - Intronic
1045309072 8:100984800-100984822 CTTTTCTCTAGGGCAGAGGAAGG - Intergenic
1045620967 8:103977948-103977970 TCTTTCTGTAGGTCAGTAGGTGG + Intronic
1047011684 8:120679405-120679427 TCTTGATGGAGGGCAGAGGTAGG - Intronic
1047097924 8:121643494-121643516 TCTTTCTTTGGGGTAGAGATGGG - Intergenic
1047903277 8:129446523-129446545 TCTTTCAATAGGGCTGAGATGGG + Intergenic
1048034960 8:130668947-130668969 TGTTTCTATAGGGGAGAAGTTGG + Intergenic
1048530174 8:135240819-135240841 GATTTCTGTAGGGCAGCAGTTGG - Intergenic
1048549787 8:135423836-135423858 ACTTTCTGTAGAGAAGAAGTGGG + Intergenic
1050009975 9:1175434-1175456 TTTTACTCTAGGCCAGAGGTTGG - Intergenic
1050228111 9:3484917-3484939 TCTTTCTGTAGAGATGGGGTGGG - Intronic
1051050000 9:12921285-12921307 TCTGTCTTTAGGATAGAGGTGGG - Intergenic
1052855448 9:33403627-33403649 TCTTTCTGCAGGGGTGAGGCAGG + Intergenic
1053520203 9:38769509-38769531 TTATTCTGGAGGGCAGAGGCAGG + Intergenic
1053683462 9:40499970-40499992 TCTTTCTGCAGGGGTGAGGCAGG + Intergenic
1053933441 9:43128285-43128307 TCTTTCTGCAGGGGTGAGGCAGG + Intergenic
1054280253 9:63124958-63124980 TCTTTCTGCAGGGGTGAGGCAGG - Intergenic
1054296566 9:63335468-63335490 TCTTTCTGCAGGGGTGAGGCAGG + Intergenic
1054394583 9:64639973-64639995 TCTTTCTGCAGGGGTGAGGCAGG + Intergenic
1054429232 9:65145172-65145194 TCTTTCTGCAGGGGTGAGGCAGG + Intergenic
1054501152 9:65876363-65876385 TCTTTCTGCAGGGGTGAGGCAGG - Intergenic
1054869676 9:70037909-70037931 TATGTCTCTAGGGCAGTGGTGGG - Intergenic
1057256715 9:93555026-93555048 CCTTTCTGCAGCTCAGAGGTGGG + Intronic
1059862806 9:118483828-118483850 TCCTTGTCTAAGGCAGAGGTAGG - Intergenic
1060567253 9:124604055-124604077 TCTTTCTTTAGGGTAGAACTTGG + Intronic
1060970223 9:127733556-127733578 TCCTTCTGTAGGGGAGAGACAGG + Exonic
1062582780 9:137235860-137235882 TCCTTCTGTAGGGTGGAGGAGGG + Intronic
1185855769 X:3533596-3533618 TCTGCCTGTAGGGAAGAGGCAGG - Intergenic
1187581492 X:20612145-20612167 TTTTTCTGCAGGCCAGAGGGAGG + Intergenic
1190283102 X:48944279-48944301 TCCTGCTGGAGGGAAGAGGTGGG + Exonic
1190865244 X:54379224-54379246 CATTTCGGGAGGGCAGAGGTGGG + Intergenic
1191637687 X:63394955-63394977 TCTTTCTGTAAACCAGAAGTGGG - Intergenic
1191648213 X:63506864-63506886 TCTTCCTGTACGGAAGAGGTGGG + Intergenic
1192035759 X:67561137-67561159 TCTCTCTTTAGGGCAAAGGTTGG + Intronic
1193623397 X:83786035-83786057 TCTTTGTGTTGGGCAGAGGAGGG - Intergenic
1196072667 X:111543727-111543749 ACTTTCTGGAGGGCAGGTGTGGG - Intergenic
1196793962 X:119487995-119488017 TCTTCCCGTAGGGCAGGGCTCGG - Intergenic
1198054031 X:132976258-132976280 TCTATCTGTGGGACAGGGGTGGG - Intergenic
1199347605 X:146760425-146760447 TCTTTCAGGAAAGCAGAGGTAGG + Intergenic
1199708778 X:150453171-150453193 TCATGCTCTAGGTCAGAGGTTGG + Intronic
1200252143 X:154559449-154559471 TCTGTCTGGAGGGCAGAAGCAGG - Intronic
1200265625 X:154644967-154644989 TCTGTCTGGAGGGCAGAAGCAGG + Intergenic