ID: 1133641709

View in Genome Browser
Species Human (GRCh38)
Location 16:7723488-7723510
Sequence TCTCCTGATGTTACCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133641709_1133641711 20 Left 1133641709 16:7723488-7723510 CCAGGCTGGGTAACATCAGGAGA No data
Right 1133641711 16:7723531-7723553 TAAAAATTAGCTGAACACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133641709 Original CRISPR TCTCCTGATGTTACCCAGCC TGG (reversed) Intergenic
No off target data available for this crispr