ID: 1133643486

View in Genome Browser
Species Human (GRCh38)
Location 16:7740672-7740694
Sequence CCCTCTCTGGACCTTGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133643486_1133643489 -10 Left 1133643486 16:7740672-7740694 CCTCACTCAAGGTCCAGAGAGGG No data
Right 1133643489 16:7740685-7740707 CCAGAGAGGGAAGACCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133643486 Original CRISPR CCCTCTCTGGACCTTGAGTG AGG (reversed) Intergenic
No off target data available for this crispr