ID: 1133645159

View in Genome Browser
Species Human (GRCh38)
Location 16:7757156-7757178
Sequence GTATATACACAGAATAATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133645154_1133645159 7 Left 1133645154 16:7757126-7757148 CCATCAGCAATTCCAACTTGACC No data
Right 1133645159 16:7757156-7757178 GTATATACACAGAATAATCTAGG No data
1133645156_1133645159 -5 Left 1133645156 16:7757138-7757160 CCAACTTGACCCAAATAGGTATA No data
Right 1133645159 16:7757156-7757178 GTATATACACAGAATAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133645159 Original CRISPR GTATATACACAGAATAATCT AGG Intergenic
No off target data available for this crispr