ID: 1133647740

View in Genome Browser
Species Human (GRCh38)
Location 16:7780288-7780310
Sequence GTTGACAAAACGAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133647736_1133647740 1 Left 1133647736 16:7780264-7780286 CCTATGGACACAAACAAGGCTCA No data
Right 1133647740 16:7780288-7780310 GTTGACAAAACGAAGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133647740 Original CRISPR GTTGACAAAACGAAGGAGGG TGG Intergenic
No off target data available for this crispr