ID: 1133652883

View in Genome Browser
Species Human (GRCh38)
Location 16:7829601-7829623
Sequence CTTTAAAAGAGGAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133652883_1133652893 6 Left 1133652883 16:7829601-7829623 CCACCCACCTTCCTCTTTTAAAG No data
Right 1133652893 16:7829630-7829652 GTGATTACACTGGGCTAAACTGG No data
1133652883_1133652889 -3 Left 1133652883 16:7829601-7829623 CCACCCACCTTCCTCTTTTAAAG No data
Right 1133652889 16:7829621-7829643 AAGACCCCTGTGATTACACTGGG No data
1133652883_1133652888 -4 Left 1133652883 16:7829601-7829623 CCACCCACCTTCCTCTTTTAAAG No data
Right 1133652888 16:7829620-7829642 AAAGACCCCTGTGATTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133652883 Original CRISPR CTTTAAAAGAGGAAGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr