ID: 1133654431

View in Genome Browser
Species Human (GRCh38)
Location 16:7846609-7846631
Sequence ATCCCCAAGGGGAAGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133654431_1133654437 4 Left 1133654431 16:7846609-7846631 CCTCCCATCTTCCCCTTGGGGAT No data
Right 1133654437 16:7846636-7846658 ACAGCTCAGAAGCATATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133654431 Original CRISPR ATCCCCAAGGGGAAGATGGG AGG (reversed) Intergenic
No off target data available for this crispr