ID: 1133654437

View in Genome Browser
Species Human (GRCh38)
Location 16:7846636-7846658
Sequence ACAGCTCAGAAGCATATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133654431_1133654437 4 Left 1133654431 16:7846609-7846631 CCTCCCATCTTCCCCTTGGGGAT No data
Right 1133654437 16:7846636-7846658 ACAGCTCAGAAGCATATTAAAGG No data
1133654426_1133654437 26 Left 1133654426 16:7846587-7846609 CCACATGCGATTTATCTGTATCC No data
Right 1133654437 16:7846636-7846658 ACAGCTCAGAAGCATATTAAAGG No data
1133654432_1133654437 1 Left 1133654432 16:7846612-7846634 CCCATCTTCCCCTTGGGGATATT No data
Right 1133654437 16:7846636-7846658 ACAGCTCAGAAGCATATTAAAGG No data
1133654434_1133654437 -7 Left 1133654434 16:7846620-7846642 CCCCTTGGGGATATTTACAGCTC No data
Right 1133654437 16:7846636-7846658 ACAGCTCAGAAGCATATTAAAGG No data
1133654430_1133654437 5 Left 1133654430 16:7846608-7846630 CCCTCCCATCTTCCCCTTGGGGA No data
Right 1133654437 16:7846636-7846658 ACAGCTCAGAAGCATATTAAAGG No data
1133654435_1133654437 -8 Left 1133654435 16:7846621-7846643 CCCTTGGGGATATTTACAGCTCA No data
Right 1133654437 16:7846636-7846658 ACAGCTCAGAAGCATATTAAAGG No data
1133654433_1133654437 0 Left 1133654433 16:7846613-7846635 CCATCTTCCCCTTGGGGATATTT No data
Right 1133654437 16:7846636-7846658 ACAGCTCAGAAGCATATTAAAGG No data
1133654436_1133654437 -9 Left 1133654436 16:7846622-7846644 CCTTGGGGATATTTACAGCTCAG No data
Right 1133654437 16:7846636-7846658 ACAGCTCAGAAGCATATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133654437 Original CRISPR ACAGCTCAGAAGCATATTAA AGG Intergenic
No off target data available for this crispr