ID: 1133658543

View in Genome Browser
Species Human (GRCh38)
Location 16:7891301-7891323
Sequence AGCACCATGCTTTTACTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133658539_1133658543 -9 Left 1133658539 16:7891287-7891309 CCCACTTTTCTGATAGCACCATG No data
Right 1133658543 16:7891301-7891323 AGCACCATGCTTTTACTTTGGGG No data
1133658540_1133658543 -10 Left 1133658540 16:7891288-7891310 CCACTTTTCTGATAGCACCATGC No data
Right 1133658543 16:7891301-7891323 AGCACCATGCTTTTACTTTGGGG No data
1133658538_1133658543 -3 Left 1133658538 16:7891281-7891303 CCATTTCCCACTTTTCTGATAGC No data
Right 1133658543 16:7891301-7891323 AGCACCATGCTTTTACTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133658543 Original CRISPR AGCACCATGCTTTTACTTTG GGG Intergenic
No off target data available for this crispr