ID: 1133658933

View in Genome Browser
Species Human (GRCh38)
Location 16:7895920-7895942
Sequence GCCCACACCCTTCCAAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133658933_1133658937 18 Left 1133658933 16:7895920-7895942 CCCTTCTTTGGAAGGGTGTGGGC No data
Right 1133658937 16:7895961-7895983 TTAAATCCATTAAGTCATTACGG No data
1133658933_1133658939 27 Left 1133658933 16:7895920-7895942 CCCTTCTTTGGAAGGGTGTGGGC No data
Right 1133658939 16:7895970-7895992 TTAAGTCATTACGGTCCCTCAGG No data
1133658933_1133658936 -5 Left 1133658933 16:7895920-7895942 CCCTTCTTTGGAAGGGTGTGGGC No data
Right 1133658936 16:7895938-7895960 TGGGCTGGAGCTCATAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133658933 Original CRISPR GCCCACACCCTTCCAAAGAA GGG (reversed) Intergenic
No off target data available for this crispr