ID: 1133667487

View in Genome Browser
Species Human (GRCh38)
Location 16:7983456-7983478
Sequence CTGCTCACTGAACCAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133667487_1133667489 1 Left 1133667487 16:7983456-7983478 CCAGCCTCTGGTTCAGTGAGCAG No data
Right 1133667489 16:7983480-7983502 AAAACACAAGTTAATTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133667487 Original CRISPR CTGCTCACTGAACCAGAGGC TGG (reversed) Intergenic
No off target data available for this crispr