ID: 1133667489

View in Genome Browser
Species Human (GRCh38)
Location 16:7983480-7983502
Sequence AAAACACAAGTTAATTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133667486_1133667489 2 Left 1133667486 16:7983455-7983477 CCCAGCCTCTGGTTCAGTGAGCA No data
Right 1133667489 16:7983480-7983502 AAAACACAAGTTAATTGCAAAGG No data
1133667487_1133667489 1 Left 1133667487 16:7983456-7983478 CCAGCCTCTGGTTCAGTGAGCAG No data
Right 1133667489 16:7983480-7983502 AAAACACAAGTTAATTGCAAAGG No data
1133667488_1133667489 -3 Left 1133667488 16:7983460-7983482 CCTCTGGTTCAGTGAGCAGCAAA No data
Right 1133667489 16:7983480-7983502 AAAACACAAGTTAATTGCAAAGG No data
1133667484_1133667489 19 Left 1133667484 16:7983438-7983460 CCAAACAAAAATGCACACCCAGC No data
Right 1133667489 16:7983480-7983502 AAAACACAAGTTAATTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133667489 Original CRISPR AAAACACAAGTTAATTGCAA AGG Intergenic
No off target data available for this crispr