ID: 1133669070

View in Genome Browser
Species Human (GRCh38)
Location 16:7999901-7999923
Sequence GTCCAGATCTTTAGGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133669061_1133669070 30 Left 1133669061 16:7999848-7999870 CCAGGGATAGGAGATGTGCTGAT No data
Right 1133669070 16:7999901-7999923 GTCCAGATCTTTAGGAAGGATGG No data
1133669065_1133669070 -3 Left 1133669065 16:7999881-7999903 CCAACCAAACTAAACCTCAGGTC No data
Right 1133669070 16:7999901-7999923 GTCCAGATCTTTAGGAAGGATGG No data
1133669066_1133669070 -7 Left 1133669066 16:7999885-7999907 CCAAACTAAACCTCAGGTCCAGA No data
Right 1133669070 16:7999901-7999923 GTCCAGATCTTTAGGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133669070 Original CRISPR GTCCAGATCTTTAGGAAGGA TGG Intergenic
No off target data available for this crispr