ID: 1133669721

View in Genome Browser
Species Human (GRCh38)
Location 16:8006622-8006644
Sequence AAGAATCCCGAAAAGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133669721_1133669723 3 Left 1133669721 16:8006622-8006644 CCATTCTCCTTTTCGGGATTCTT No data
Right 1133669723 16:8006648-8006670 TCCCCCAGCAAGAGCTTCCCTGG No data
1133669721_1133669728 19 Left 1133669721 16:8006622-8006644 CCATTCTCCTTTTCGGGATTCTT No data
Right 1133669728 16:8006664-8006686 TCCCTGGTGAAATGTGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133669721 Original CRISPR AAGAATCCCGAAAAGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr