ID: 1133678333

View in Genome Browser
Species Human (GRCh38)
Location 16:8096921-8096943
Sequence GGCCATAGCTGACCACACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133678333_1133678337 9 Left 1133678333 16:8096921-8096943 CCTCGGTGTGGTCAGCTATGGCC No data
Right 1133678337 16:8096953-8096975 AACATAGATTTTATTGTTTATGG No data
1133678333_1133678342 25 Left 1133678333 16:8096921-8096943 CCTCGGTGTGGTCAGCTATGGCC No data
Right 1133678342 16:8096969-8096991 TTTATGGAGGGAAATCAGTGGGG No data
1133678333_1133678340 23 Left 1133678333 16:8096921-8096943 CCTCGGTGTGGTCAGCTATGGCC No data
Right 1133678340 16:8096967-8096989 TGTTTATGGAGGGAAATCAGTGG No data
1133678333_1133678339 13 Left 1133678333 16:8096921-8096943 CCTCGGTGTGGTCAGCTATGGCC No data
Right 1133678339 16:8096957-8096979 TAGATTTTATTGTTTATGGAGGG No data
1133678333_1133678343 26 Left 1133678333 16:8096921-8096943 CCTCGGTGTGGTCAGCTATGGCC No data
Right 1133678343 16:8096970-8096992 TTATGGAGGGAAATCAGTGGGGG No data
1133678333_1133678341 24 Left 1133678333 16:8096921-8096943 CCTCGGTGTGGTCAGCTATGGCC No data
Right 1133678341 16:8096968-8096990 GTTTATGGAGGGAAATCAGTGGG No data
1133678333_1133678338 12 Left 1133678333 16:8096921-8096943 CCTCGGTGTGGTCAGCTATGGCC No data
Right 1133678338 16:8096956-8096978 ATAGATTTTATTGTTTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133678333 Original CRISPR GGCCATAGCTGACCACACCG AGG (reversed) Intergenic
No off target data available for this crispr