ID: 1133679744

View in Genome Browser
Species Human (GRCh38)
Location 16:8109729-8109751
Sequence GCAACTAGACATGTTCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133679744_1133679745 -10 Left 1133679744 16:8109729-8109751 CCATCTTGAACATGTCTAGTTGC No data
Right 1133679745 16:8109742-8109764 GTCTAGTTGCTAGTACCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133679744 Original CRISPR GCAACTAGACATGTTCAAGA TGG (reversed) Intergenic
No off target data available for this crispr