ID: 1133682061

View in Genome Browser
Species Human (GRCh38)
Location 16:8129048-8129070
Sequence GATCTCCTGAGCCTGTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133682061_1133682068 16 Left 1133682061 16:8129048-8129070 CCAAGACACAGGCTCAGGAGATC No data
Right 1133682068 16:8129087-8129109 AAGGTGGTTGGTGCACAGCTTGG No data
1133682061_1133682065 4 Left 1133682061 16:8129048-8129070 CCAAGACACAGGCTCAGGAGATC No data
Right 1133682065 16:8129075-8129097 CAACATGTGCCCAAGGTGGTTGG 0: 55
1: 404
2: 690
3: 673
4: 554
1133682061_1133682064 0 Left 1133682061 16:8129048-8129070 CCAAGACACAGGCTCAGGAGATC No data
Right 1133682064 16:8129071-8129093 CTGACAACATGTGCCCAAGGTGG 0: 96
1: 678
2: 1156
3: 1053
4: 697
1133682061_1133682062 -3 Left 1133682061 16:8129048-8129070 CCAAGACACAGGCTCAGGAGATC No data
Right 1133682062 16:8129068-8129090 ATCCTGACAACATGTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133682061 Original CRISPR GATCTCCTGAGCCTGTGTCT TGG (reversed) Intergenic
No off target data available for this crispr