ID: 1133682062

View in Genome Browser
Species Human (GRCh38)
Location 16:8129068-8129090
Sequence ATCCTGACAACATGTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133682061_1133682062 -3 Left 1133682061 16:8129048-8129070 CCAAGACACAGGCTCAGGAGATC No data
Right 1133682062 16:8129068-8129090 ATCCTGACAACATGTGCCCAAGG No data
1133682060_1133682062 -2 Left 1133682060 16:8129047-8129069 CCCAAGACACAGGCTCAGGAGAT No data
Right 1133682062 16:8129068-8129090 ATCCTGACAACATGTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133682062 Original CRISPR ATCCTGACAACATGTGCCCA AGG Intergenic
No off target data available for this crispr