ID: 1133682064

View in Genome Browser
Species Human (GRCh38)
Location 16:8129071-8129093
Sequence CTGACAACATGTGCCCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3680
Summary {0: 96, 1: 678, 2: 1156, 3: 1053, 4: 697}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133682060_1133682064 1 Left 1133682060 16:8129047-8129069 CCCAAGACACAGGCTCAGGAGAT No data
Right 1133682064 16:8129071-8129093 CTGACAACATGTGCCCAAGGTGG 0: 96
1: 678
2: 1156
3: 1053
4: 697
1133682061_1133682064 0 Left 1133682061 16:8129048-8129070 CCAAGACACAGGCTCAGGAGATC No data
Right 1133682064 16:8129071-8129093 CTGACAACATGTGCCCAAGGTGG 0: 96
1: 678
2: 1156
3: 1053
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133682064 Original CRISPR CTGACAACATGTGCCCAAGG TGG Intergenic
Too many off-targets to display for this crispr