ID: 1133682065

View in Genome Browser
Species Human (GRCh38)
Location 16:8129075-8129097
Sequence CAACATGTGCCCAAGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2376
Summary {0: 55, 1: 404, 2: 690, 3: 673, 4: 554}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133682060_1133682065 5 Left 1133682060 16:8129047-8129069 CCCAAGACACAGGCTCAGGAGAT No data
Right 1133682065 16:8129075-8129097 CAACATGTGCCCAAGGTGGTTGG 0: 55
1: 404
2: 690
3: 673
4: 554
1133682061_1133682065 4 Left 1133682061 16:8129048-8129070 CCAAGACACAGGCTCAGGAGATC No data
Right 1133682065 16:8129075-8129097 CAACATGTGCCCAAGGTGGTTGG 0: 55
1: 404
2: 690
3: 673
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133682065 Original CRISPR CAACATGTGCCCAAGGTGGT TGG Intergenic
Too many off-targets to display for this crispr