ID: 1133682068

View in Genome Browser
Species Human (GRCh38)
Location 16:8129087-8129109
Sequence AAGGTGGTTGGTGCACAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133682063_1133682068 -6 Left 1133682063 16:8129070-8129092 CCTGACAACATGTGCCCAAGGTG 0: 93
1: 683
2: 1210
3: 1145
4: 791
Right 1133682068 16:8129087-8129109 AAGGTGGTTGGTGCACAGCTTGG No data
1133682061_1133682068 16 Left 1133682061 16:8129048-8129070 CCAAGACACAGGCTCAGGAGATC No data
Right 1133682068 16:8129087-8129109 AAGGTGGTTGGTGCACAGCTTGG No data
1133682060_1133682068 17 Left 1133682060 16:8129047-8129069 CCCAAGACACAGGCTCAGGAGAT No data
Right 1133682068 16:8129087-8129109 AAGGTGGTTGGTGCACAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133682068 Original CRISPR AAGGTGGTTGGTGCACAGCT TGG Intergenic
No off target data available for this crispr