ID: 1133686980

View in Genome Browser
Species Human (GRCh38)
Location 16:8174771-8174793
Sequence TCAAGTATGTAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133686980_1133686987 28 Left 1133686980 16:8174771-8174793 CCATCCTCCTTCTACATACTTGA No data
Right 1133686987 16:8174822-8174844 TCAGGAATAAATGCAGCTGGAGG No data
1133686980_1133686983 2 Left 1133686980 16:8174771-8174793 CCATCCTCCTTCTACATACTTGA No data
Right 1133686983 16:8174796-8174818 TTGCAATAGTCCACTTAAAGTGG No data
1133686980_1133686984 10 Left 1133686980 16:8174771-8174793 CCATCCTCCTTCTACATACTTGA No data
Right 1133686984 16:8174804-8174826 GTCCACTTAAAGTGGCTTTCAGG No data
1133686980_1133686986 25 Left 1133686980 16:8174771-8174793 CCATCCTCCTTCTACATACTTGA No data
Right 1133686986 16:8174819-8174841 CTTTCAGGAATAAATGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133686980 Original CRISPR TCAAGTATGTAGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr