ID: 1133689881

View in Genome Browser
Species Human (GRCh38)
Location 16:8203237-8203259
Sequence CTGTTCCTGCAGAAGCCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133689881_1133689887 24 Left 1133689881 16:8203237-8203259 CCTAATGGCTTCTGCAGGAACAG No data
Right 1133689887 16:8203284-8203306 TGTAGATGCCTGCTCCAGCGAGG No data
1133689881_1133689888 25 Left 1133689881 16:8203237-8203259 CCTAATGGCTTCTGCAGGAACAG No data
Right 1133689888 16:8203285-8203307 GTAGATGCCTGCTCCAGCGAGGG No data
1133689881_1133689885 -9 Left 1133689881 16:8203237-8203259 CCTAATGGCTTCTGCAGGAACAG No data
Right 1133689885 16:8203251-8203273 CAGGAACAGTTTATTGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133689881 Original CRISPR CTGTTCCTGCAGAAGCCATT AGG (reversed) Intergenic
No off target data available for this crispr