ID: 1133690807

View in Genome Browser
Species Human (GRCh38)
Location 16:8213231-8213253
Sequence GCTCTCAGGGGTTTTATAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133690807_1133690818 20 Left 1133690807 16:8213231-8213253 CCTCCTATAAAACCCCTGAGAGC No data
Right 1133690818 16:8213274-8213296 TGTGATCCCAGCATTTTGGAAGG 0: 10
1: 936
2: 28275
3: 332342
4: 266203
1133690807_1133690817 16 Left 1133690807 16:8213231-8213253 CCTCCTATAAAACCCCTGAGAGC No data
Right 1133690817 16:8213270-8213292 CACTTGTGATCCCAGCATTTTGG No data
1133690807_1133690823 30 Left 1133690807 16:8213231-8213253 CCTCCTATAAAACCCCTGAGAGC No data
Right 1133690823 16:8213284-8213306 GCATTTTGGAAGGCTGAGGCGGG 0: 135
1: 5471
2: 77120
3: 203106
4: 329783
1133690807_1133690820 26 Left 1133690807 16:8213231-8213253 CCTCCTATAAAACCCCTGAGAGC No data
Right 1133690820 16:8213280-8213302 CCCAGCATTTTGGAAGGCTGAGG 0: 214
1: 7814
2: 105433
3: 233781
4: 346197
1133690807_1133690822 29 Left 1133690807 16:8213231-8213253 CCTCCTATAAAACCCCTGAGAGC No data
Right 1133690822 16:8213283-8213305 AGCATTTTGGAAGGCTGAGGCGG 0: 126
1: 5488
2: 74562
3: 161722
4: 172592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133690807 Original CRISPR GCTCTCAGGGGTTTTATAGG AGG (reversed) Intergenic
No off target data available for this crispr