ID: 1133690808

View in Genome Browser
Species Human (GRCh38)
Location 16:8213234-8213256
Sequence CCGGCTCTCAGGGGTTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133690808_1133690820 23 Left 1133690808 16:8213234-8213256 CCTATAAAACCCCTGAGAGCCGG No data
Right 1133690820 16:8213280-8213302 CCCAGCATTTTGGAAGGCTGAGG 0: 214
1: 7814
2: 105433
3: 233781
4: 346197
1133690808_1133690823 27 Left 1133690808 16:8213234-8213256 CCTATAAAACCCCTGAGAGCCGG No data
Right 1133690823 16:8213284-8213306 GCATTTTGGAAGGCTGAGGCGGG 0: 135
1: 5471
2: 77120
3: 203106
4: 329783
1133690808_1133690818 17 Left 1133690808 16:8213234-8213256 CCTATAAAACCCCTGAGAGCCGG No data
Right 1133690818 16:8213274-8213296 TGTGATCCCAGCATTTTGGAAGG 0: 10
1: 936
2: 28275
3: 332342
4: 266203
1133690808_1133690817 13 Left 1133690808 16:8213234-8213256 CCTATAAAACCCCTGAGAGCCGG No data
Right 1133690817 16:8213270-8213292 CACTTGTGATCCCAGCATTTTGG No data
1133690808_1133690822 26 Left 1133690808 16:8213234-8213256 CCTATAAAACCCCTGAGAGCCGG No data
Right 1133690822 16:8213283-8213305 AGCATTTTGGAAGGCTGAGGCGG 0: 126
1: 5488
2: 74562
3: 161722
4: 172592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133690808 Original CRISPR CCGGCTCTCAGGGGTTTTAT AGG (reversed) Intergenic
No off target data available for this crispr