ID: 1133690817

View in Genome Browser
Species Human (GRCh38)
Location 16:8213270-8213292
Sequence CACTTGTGATCCCAGCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133690808_1133690817 13 Left 1133690808 16:8213234-8213256 CCTATAAAACCCCTGAGAGCCGG No data
Right 1133690817 16:8213270-8213292 CACTTGTGATCCCAGCATTTTGG No data
1133690807_1133690817 16 Left 1133690807 16:8213231-8213253 CCTCCTATAAAACCCCTGAGAGC No data
Right 1133690817 16:8213270-8213292 CACTTGTGATCCCAGCATTTTGG No data
1133690815_1133690817 2 Left 1133690815 16:8213245-8213267 CCTGAGAGCCGGGTGCGGTGGCT No data
Right 1133690817 16:8213270-8213292 CACTTGTGATCCCAGCATTTTGG No data
1133690816_1133690817 -6 Left 1133690816 16:8213253-8213275 CCGGGTGCGGTGGCTTGCACTTG No data
Right 1133690817 16:8213270-8213292 CACTTGTGATCCCAGCATTTTGG No data
1133690814_1133690817 3 Left 1133690814 16:8213244-8213266 CCCTGAGAGCCGGGTGCGGTGGC No data
Right 1133690817 16:8213270-8213292 CACTTGTGATCCCAGCATTTTGG No data
1133690812_1133690817 4 Left 1133690812 16:8213243-8213265 CCCCTGAGAGCCGGGTGCGGTGG No data
Right 1133690817 16:8213270-8213292 CACTTGTGATCCCAGCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133690817 Original CRISPR CACTTGTGATCCCAGCATTT TGG Intergenic
No off target data available for this crispr