ID: 1133690818

View in Genome Browser
Species Human (GRCh38)
Location 16:8213274-8213296
Sequence TGTGATCCCAGCATTTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 627766
Summary {0: 10, 1: 936, 2: 28275, 3: 332342, 4: 266203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133690808_1133690818 17 Left 1133690808 16:8213234-8213256 CCTATAAAACCCCTGAGAGCCGG No data
Right 1133690818 16:8213274-8213296 TGTGATCCCAGCATTTTGGAAGG 0: 10
1: 936
2: 28275
3: 332342
4: 266203
1133690814_1133690818 7 Left 1133690814 16:8213244-8213266 CCCTGAGAGCCGGGTGCGGTGGC No data
Right 1133690818 16:8213274-8213296 TGTGATCCCAGCATTTTGGAAGG 0: 10
1: 936
2: 28275
3: 332342
4: 266203
1133690816_1133690818 -2 Left 1133690816 16:8213253-8213275 CCGGGTGCGGTGGCTTGCACTTG No data
Right 1133690818 16:8213274-8213296 TGTGATCCCAGCATTTTGGAAGG 0: 10
1: 936
2: 28275
3: 332342
4: 266203
1133690815_1133690818 6 Left 1133690815 16:8213245-8213267 CCTGAGAGCCGGGTGCGGTGGCT No data
Right 1133690818 16:8213274-8213296 TGTGATCCCAGCATTTTGGAAGG 0: 10
1: 936
2: 28275
3: 332342
4: 266203
1133690812_1133690818 8 Left 1133690812 16:8213243-8213265 CCCCTGAGAGCCGGGTGCGGTGG No data
Right 1133690818 16:8213274-8213296 TGTGATCCCAGCATTTTGGAAGG 0: 10
1: 936
2: 28275
3: 332342
4: 266203
1133690807_1133690818 20 Left 1133690807 16:8213231-8213253 CCTCCTATAAAACCCCTGAGAGC No data
Right 1133690818 16:8213274-8213296 TGTGATCCCAGCATTTTGGAAGG 0: 10
1: 936
2: 28275
3: 332342
4: 266203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133690818 Original CRISPR TGTGATCCCAGCATTTTGGA AGG Intergenic
Too many off-targets to display for this crispr