ID: 1133690820

View in Genome Browser
Species Human (GRCh38)
Location 16:8213280-8213302
Sequence CCCAGCATTTTGGAAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 693439
Summary {0: 214, 1: 7814, 2: 105433, 3: 233781, 4: 346197}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133690812_1133690820 14 Left 1133690812 16:8213243-8213265 CCCCTGAGAGCCGGGTGCGGTGG No data
Right 1133690820 16:8213280-8213302 CCCAGCATTTTGGAAGGCTGAGG 0: 214
1: 7814
2: 105433
3: 233781
4: 346197
1133690808_1133690820 23 Left 1133690808 16:8213234-8213256 CCTATAAAACCCCTGAGAGCCGG No data
Right 1133690820 16:8213280-8213302 CCCAGCATTTTGGAAGGCTGAGG 0: 214
1: 7814
2: 105433
3: 233781
4: 346197
1133690814_1133690820 13 Left 1133690814 16:8213244-8213266 CCCTGAGAGCCGGGTGCGGTGGC No data
Right 1133690820 16:8213280-8213302 CCCAGCATTTTGGAAGGCTGAGG 0: 214
1: 7814
2: 105433
3: 233781
4: 346197
1133690815_1133690820 12 Left 1133690815 16:8213245-8213267 CCTGAGAGCCGGGTGCGGTGGCT No data
Right 1133690820 16:8213280-8213302 CCCAGCATTTTGGAAGGCTGAGG 0: 214
1: 7814
2: 105433
3: 233781
4: 346197
1133690807_1133690820 26 Left 1133690807 16:8213231-8213253 CCTCCTATAAAACCCCTGAGAGC No data
Right 1133690820 16:8213280-8213302 CCCAGCATTTTGGAAGGCTGAGG 0: 214
1: 7814
2: 105433
3: 233781
4: 346197
1133690816_1133690820 4 Left 1133690816 16:8213253-8213275 CCGGGTGCGGTGGCTTGCACTTG No data
Right 1133690820 16:8213280-8213302 CCCAGCATTTTGGAAGGCTGAGG 0: 214
1: 7814
2: 105433
3: 233781
4: 346197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133690820 Original CRISPR CCCAGCATTTTGGAAGGCTG AGG Intergenic
Too many off-targets to display for this crispr