ID: 1133690822

View in Genome Browser
Species Human (GRCh38)
Location 16:8213283-8213305
Sequence AGCATTTTGGAAGGCTGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 414490
Summary {0: 126, 1: 5488, 2: 74562, 3: 161722, 4: 172592}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133690812_1133690822 17 Left 1133690812 16:8213243-8213265 CCCCTGAGAGCCGGGTGCGGTGG No data
Right 1133690822 16:8213283-8213305 AGCATTTTGGAAGGCTGAGGCGG 0: 126
1: 5488
2: 74562
3: 161722
4: 172592
1133690815_1133690822 15 Left 1133690815 16:8213245-8213267 CCTGAGAGCCGGGTGCGGTGGCT No data
Right 1133690822 16:8213283-8213305 AGCATTTTGGAAGGCTGAGGCGG 0: 126
1: 5488
2: 74562
3: 161722
4: 172592
1133690814_1133690822 16 Left 1133690814 16:8213244-8213266 CCCTGAGAGCCGGGTGCGGTGGC No data
Right 1133690822 16:8213283-8213305 AGCATTTTGGAAGGCTGAGGCGG 0: 126
1: 5488
2: 74562
3: 161722
4: 172592
1133690816_1133690822 7 Left 1133690816 16:8213253-8213275 CCGGGTGCGGTGGCTTGCACTTG No data
Right 1133690822 16:8213283-8213305 AGCATTTTGGAAGGCTGAGGCGG 0: 126
1: 5488
2: 74562
3: 161722
4: 172592
1133690807_1133690822 29 Left 1133690807 16:8213231-8213253 CCTCCTATAAAACCCCTGAGAGC No data
Right 1133690822 16:8213283-8213305 AGCATTTTGGAAGGCTGAGGCGG 0: 126
1: 5488
2: 74562
3: 161722
4: 172592
1133690808_1133690822 26 Left 1133690808 16:8213234-8213256 CCTATAAAACCCCTGAGAGCCGG No data
Right 1133690822 16:8213283-8213305 AGCATTTTGGAAGGCTGAGGCGG 0: 126
1: 5488
2: 74562
3: 161722
4: 172592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133690822 Original CRISPR AGCATTTTGGAAGGCTGAGG CGG Intergenic
Too many off-targets to display for this crispr