ID: 1133690823

View in Genome Browser
Species Human (GRCh38)
Location 16:8213284-8213306
Sequence GCATTTTGGAAGGCTGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 615615
Summary {0: 135, 1: 5471, 2: 77120, 3: 203106, 4: 329783}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133690807_1133690823 30 Left 1133690807 16:8213231-8213253 CCTCCTATAAAACCCCTGAGAGC No data
Right 1133690823 16:8213284-8213306 GCATTTTGGAAGGCTGAGGCGGG 0: 135
1: 5471
2: 77120
3: 203106
4: 329783
1133690814_1133690823 17 Left 1133690814 16:8213244-8213266 CCCTGAGAGCCGGGTGCGGTGGC No data
Right 1133690823 16:8213284-8213306 GCATTTTGGAAGGCTGAGGCGGG 0: 135
1: 5471
2: 77120
3: 203106
4: 329783
1133690815_1133690823 16 Left 1133690815 16:8213245-8213267 CCTGAGAGCCGGGTGCGGTGGCT No data
Right 1133690823 16:8213284-8213306 GCATTTTGGAAGGCTGAGGCGGG 0: 135
1: 5471
2: 77120
3: 203106
4: 329783
1133690808_1133690823 27 Left 1133690808 16:8213234-8213256 CCTATAAAACCCCTGAGAGCCGG No data
Right 1133690823 16:8213284-8213306 GCATTTTGGAAGGCTGAGGCGGG 0: 135
1: 5471
2: 77120
3: 203106
4: 329783
1133690812_1133690823 18 Left 1133690812 16:8213243-8213265 CCCCTGAGAGCCGGGTGCGGTGG No data
Right 1133690823 16:8213284-8213306 GCATTTTGGAAGGCTGAGGCGGG 0: 135
1: 5471
2: 77120
3: 203106
4: 329783
1133690816_1133690823 8 Left 1133690816 16:8213253-8213275 CCGGGTGCGGTGGCTTGCACTTG No data
Right 1133690823 16:8213284-8213306 GCATTTTGGAAGGCTGAGGCGGG 0: 135
1: 5471
2: 77120
3: 203106
4: 329783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133690823 Original CRISPR GCATTTTGGAAGGCTGAGGC GGG Intergenic
Too many off-targets to display for this crispr