ID: 1133690824

View in Genome Browser
Species Human (GRCh38)
Location 16:8213297-8213319
Sequence CTGAGGCGGGTTATCACCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133690815_1133690824 29 Left 1133690815 16:8213245-8213267 CCTGAGAGCCGGGTGCGGTGGCT No data
Right 1133690824 16:8213297-8213319 CTGAGGCGGGTTATCACCTTAGG No data
1133690821_1133690824 -7 Left 1133690821 16:8213281-8213303 CCAGCATTTTGGAAGGCTGAGGC 0: 131
1: 5227
2: 73482
3: 195599
4: 325458
Right 1133690824 16:8213297-8213319 CTGAGGCGGGTTATCACCTTAGG No data
1133690816_1133690824 21 Left 1133690816 16:8213253-8213275 CCGGGTGCGGTGGCTTGCACTTG No data
Right 1133690824 16:8213297-8213319 CTGAGGCGGGTTATCACCTTAGG No data
1133690819_1133690824 -6 Left 1133690819 16:8213280-8213302 CCCAGCATTTTGGAAGGCTGAGG 0: 230
1: 8504
2: 112326
3: 240815
4: 350938
Right 1133690824 16:8213297-8213319 CTGAGGCGGGTTATCACCTTAGG No data
1133690814_1133690824 30 Left 1133690814 16:8213244-8213266 CCCTGAGAGCCGGGTGCGGTGGC No data
Right 1133690824 16:8213297-8213319 CTGAGGCGGGTTATCACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133690824 Original CRISPR CTGAGGCGGGTTATCACCTT AGG Intergenic
No off target data available for this crispr