ID: 1133693128

View in Genome Browser
Species Human (GRCh38)
Location 16:8235491-8235513
Sequence TTCAGCACTGTGAGAGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133693126_1133693128 19 Left 1133693126 16:8235449-8235471 CCAGGCTGATCAGAGCAGCAGTG No data
Right 1133693128 16:8235491-8235513 TTCAGCACTGTGAGAGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133693128 Original CRISPR TTCAGCACTGTGAGAGCAAG AGG Intergenic
No off target data available for this crispr