ID: 1133693274

View in Genome Browser
Species Human (GRCh38)
Location 16:8236573-8236595
Sequence CATGAGAGGGACCCAGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133693274_1133693283 20 Left 1133693274 16:8236573-8236595 CCGTCCACTGGGTCCCTCTCATG No data
Right 1133693283 16:8236616-8236638 CTACAATTCAAGATGAGATCTGG 0: 90
1: 4290
2: 7393
3: 9089
4: 9077
1133693274_1133693281 -6 Left 1133693274 16:8236573-8236595 CCGTCCACTGGGTCCCTCTCATG No data
Right 1133693281 16:8236590-8236612 CTCATGACAGGTGGGAATTGTGG No data
1133693274_1133693282 -5 Left 1133693274 16:8236573-8236595 CCGTCCACTGGGTCCCTCTCATG No data
Right 1133693282 16:8236591-8236613 TCATGACAGGTGGGAATTGTGGG No data
1133693274_1133693284 21 Left 1133693274 16:8236573-8236595 CCGTCCACTGGGTCCCTCTCATG No data
Right 1133693284 16:8236617-8236639 TACAATTCAAGATGAGATCTGGG 0: 163
1: 7168
2: 10574
3: 9468
4: 7823
1133693274_1133693286 25 Left 1133693274 16:8236573-8236595 CCGTCCACTGGGTCCCTCTCATG No data
Right 1133693286 16:8236621-8236643 ATTCAAGATGAGATCTGGGTGGG 0: 188
1: 7916
2: 11056
3: 10152
4: 7748
1133693274_1133693287 26 Left 1133693274 16:8236573-8236595 CCGTCCACTGGGTCCCTCTCATG No data
Right 1133693287 16:8236622-8236644 TTCAAGATGAGATCTGGGTGGGG 0: 184
1: 7905
2: 11315
3: 9458
4: 7160
1133693274_1133693285 24 Left 1133693274 16:8236573-8236595 CCGTCCACTGGGTCCCTCTCATG No data
Right 1133693285 16:8236620-8236642 AATTCAAGATGAGATCTGGGTGG 0: 204
1: 7933
2: 11320
3: 9617
4: 8545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133693274 Original CRISPR CATGAGAGGGACCCAGTGGA CGG (reversed) Intergenic
No off target data available for this crispr