ID: 1133695485

View in Genome Browser
Species Human (GRCh38)
Location 16:8258677-8258699
Sequence CAAGCCCATATCATGTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133695482_1133695485 -9 Left 1133695482 16:8258663-8258685 CCTTACTCCCGGTTCAAGCCCAT No data
Right 1133695485 16:8258677-8258699 CAAGCCCATATCATGTTTTTTGG No data
1133695479_1133695485 18 Left 1133695479 16:8258636-8258658 CCTTGGGAAATCAGGGGCGCGCG No data
Right 1133695485 16:8258677-8258699 CAAGCCCATATCATGTTTTTTGG No data
1133695475_1133695485 26 Left 1133695475 16:8258628-8258650 CCAGCTCACCTTGGGAAATCAGG No data
Right 1133695485 16:8258677-8258699 CAAGCCCATATCATGTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133695485 Original CRISPR CAAGCCCATATCATGTTTTT TGG Intergenic
No off target data available for this crispr