ID: 1133703216

View in Genome Browser
Species Human (GRCh38)
Location 16:8328787-8328809
Sequence TTGTGTGTGCAATAAGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133703216_1133703217 16 Left 1133703216 16:8328787-8328809 CCTTTCACTTATTGCACACACAA No data
Right 1133703217 16:8328826-8328848 ATTGAAATGCCTCACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133703216 Original CRISPR TTGTGTGTGCAATAAGTGAA AGG (reversed) Intergenic
No off target data available for this crispr