ID: 1133703415

View in Genome Browser
Species Human (GRCh38)
Location 16:8330874-8330896
Sequence TAGGAACCTTTGGCTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133703404_1133703415 30 Left 1133703404 16:8330821-8330843 CCATTACCATCATCCAGTGAGGA No data
Right 1133703415 16:8330874-8330896 TAGGAACCTTTGGCTCAGGGAGG No data
1133703407_1133703415 17 Left 1133703407 16:8330834-8330856 CCAGTGAGGAAGGTATGATTACC No data
Right 1133703415 16:8330874-8330896 TAGGAACCTTTGGCTCAGGGAGG No data
1133703410_1133703415 -9 Left 1133703410 16:8330860-8330882 CCCACTTTATAAATTAGGAACCT No data
Right 1133703415 16:8330874-8330896 TAGGAACCTTTGGCTCAGGGAGG No data
1133703406_1133703415 24 Left 1133703406 16:8330827-8330849 CCATCATCCAGTGAGGAAGGTAT No data
Right 1133703415 16:8330874-8330896 TAGGAACCTTTGGCTCAGGGAGG No data
1133703411_1133703415 -10 Left 1133703411 16:8330861-8330883 CCACTTTATAAATTAGGAACCTT No data
Right 1133703415 16:8330874-8330896 TAGGAACCTTTGGCTCAGGGAGG No data
1133703408_1133703415 -4 Left 1133703408 16:8330855-8330877 CCATTCCCACTTTATAAATTAGG No data
Right 1133703415 16:8330874-8330896 TAGGAACCTTTGGCTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133703415 Original CRISPR TAGGAACCTTTGGCTCAGGG AGG Intergenic