ID: 1133705408 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:8350048-8350070 |
Sequence | AACAATACTGGGAGGCAAAT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1133705408_1133705414 | 24 | Left | 1133705408 | 16:8350048-8350070 | CCTATTTGCCTCCCAGTATTGTT | No data | ||
Right | 1133705414 | 16:8350095-8350117 | TCCCATAGCTGGTTGATTCTAGG | No data | ||||
1133705408_1133705413 | 13 | Left | 1133705408 | 16:8350048-8350070 | CCTATTTGCCTCCCAGTATTGTT | No data | ||
Right | 1133705413 | 16:8350084-8350106 | GCAGACGCTTTTCCCATAGCTGG | No data | ||||
1133705408_1133705416 | 25 | Left | 1133705408 | 16:8350048-8350070 | CCTATTTGCCTCCCAGTATTGTT | No data | ||
Right | 1133705416 | 16:8350096-8350118 | CCCATAGCTGGTTGATTCTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1133705408 | Original CRISPR | AACAATACTGGGAGGCAAAT AGG (reversed) | Intergenic | ||