ID: 1133705410

View in Genome Browser
Species Human (GRCh38)
Location 16:8350056-8350078
Sequence AATGCTCCAACAATACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133705410_1133705416 17 Left 1133705410 16:8350056-8350078 CCTCCCAGTATTGTTGGAGCATT No data
Right 1133705416 16:8350096-8350118 CCCATAGCTGGTTGATTCTAGGG No data
1133705410_1133705414 16 Left 1133705410 16:8350056-8350078 CCTCCCAGTATTGTTGGAGCATT No data
Right 1133705414 16:8350095-8350117 TCCCATAGCTGGTTGATTCTAGG No data
1133705410_1133705413 5 Left 1133705410 16:8350056-8350078 CCTCCCAGTATTGTTGGAGCATT No data
Right 1133705413 16:8350084-8350106 GCAGACGCTTTTCCCATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133705410 Original CRISPR AATGCTCCAACAATACTGGG AGG (reversed) Intergenic