ID: 1133705412

View in Genome Browser
Species Human (GRCh38)
Location 16:8350060-8350082
Sequence ATTAAATGCTCCAACAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133705412_1133705413 1 Left 1133705412 16:8350060-8350082 CCAGTATTGTTGGAGCATTTAAT No data
Right 1133705413 16:8350084-8350106 GCAGACGCTTTTCCCATAGCTGG No data
1133705412_1133705414 12 Left 1133705412 16:8350060-8350082 CCAGTATTGTTGGAGCATTTAAT No data
Right 1133705414 16:8350095-8350117 TCCCATAGCTGGTTGATTCTAGG No data
1133705412_1133705416 13 Left 1133705412 16:8350060-8350082 CCAGTATTGTTGGAGCATTTAAT No data
Right 1133705416 16:8350096-8350118 CCCATAGCTGGTTGATTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133705412 Original CRISPR ATTAAATGCTCCAACAATAC TGG (reversed) Intergenic