ID: 1133705413

View in Genome Browser
Species Human (GRCh38)
Location 16:8350084-8350106
Sequence GCAGACGCTTTTCCCATAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133705405_1133705413 27 Left 1133705405 16:8350034-8350056 CCCTTTCCATGTTACCTATTTGC No data
Right 1133705413 16:8350084-8350106 GCAGACGCTTTTCCCATAGCTGG No data
1133705408_1133705413 13 Left 1133705408 16:8350048-8350070 CCTATTTGCCTCCCAGTATTGTT No data
Right 1133705413 16:8350084-8350106 GCAGACGCTTTTCCCATAGCTGG No data
1133705407_1133705413 21 Left 1133705407 16:8350040-8350062 CCATGTTACCTATTTGCCTCCCA No data
Right 1133705413 16:8350084-8350106 GCAGACGCTTTTCCCATAGCTGG No data
1133705412_1133705413 1 Left 1133705412 16:8350060-8350082 CCAGTATTGTTGGAGCATTTAAT No data
Right 1133705413 16:8350084-8350106 GCAGACGCTTTTCCCATAGCTGG No data
1133705406_1133705413 26 Left 1133705406 16:8350035-8350057 CCTTTCCATGTTACCTATTTGCC No data
Right 1133705413 16:8350084-8350106 GCAGACGCTTTTCCCATAGCTGG No data
1133705411_1133705413 2 Left 1133705411 16:8350059-8350081 CCCAGTATTGTTGGAGCATTTAA No data
Right 1133705413 16:8350084-8350106 GCAGACGCTTTTCCCATAGCTGG No data
1133705410_1133705413 5 Left 1133705410 16:8350056-8350078 CCTCCCAGTATTGTTGGAGCATT No data
Right 1133705413 16:8350084-8350106 GCAGACGCTTTTCCCATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133705413 Original CRISPR GCAGACGCTTTTCCCATAGC TGG Intergenic