ID: 1133705416

View in Genome Browser
Species Human (GRCh38)
Location 16:8350096-8350118
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133705408_1133705416 25 Left 1133705408 16:8350048-8350070 CCTATTTGCCTCCCAGTATTGTT No data
Right 1133705416 16:8350096-8350118 CCCATAGCTGGTTGATTCTAGGG No data
1133705412_1133705416 13 Left 1133705412 16:8350060-8350082 CCAGTATTGTTGGAGCATTTAAT No data
Right 1133705416 16:8350096-8350118 CCCATAGCTGGTTGATTCTAGGG No data
1133705410_1133705416 17 Left 1133705410 16:8350056-8350078 CCTCCCAGTATTGTTGGAGCATT No data
Right 1133705416 16:8350096-8350118 CCCATAGCTGGTTGATTCTAGGG No data
1133705411_1133705416 14 Left 1133705411 16:8350059-8350081 CCCAGTATTGTTGGAGCATTTAA No data
Right 1133705416 16:8350096-8350118 CCCATAGCTGGTTGATTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133705416 Original CRISPR CCCATAGCTGGTTGATTCTA GGG Intergenic